Incidental Mutation 'PIT4260001:Pcdh1'
ID554524
Institutional Source Beutler Lab
Gene Symbol Pcdh1
Ensembl Gene ENSMUSG00000051375
Gene Nameprotocadherin 1
Synonyms2010005A06Rik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.406) question?
Stock #PIT4260001 (G1)
Quality Score151.008
Status Not validated
Chromosome18
Chromosomal Location38185914-38212053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38203366 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 72 (V72A)
Ref Sequence ENSEMBL: ENSMUSP00000055199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057185] [ENSMUST00000159405] [ENSMUST00000160721] [ENSMUST00000161701] [ENSMUST00000193828] [ENSMUST00000194312]
Predicted Effect probably damaging
Transcript: ENSMUST00000057185
AA Change: V72A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055199
Gene: ENSMUSG00000051375
AA Change: V72A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159405
AA Change: V72A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125309
Gene: ENSMUSG00000051375
AA Change: V72A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 2e-8 PFAM
CA 168 256 5.18e-18 SMART
CA 280 363 5.68e-24 SMART
CA 395 482 1.84e-23 SMART
CA 506 588 2.99e-32 SMART
CA 612 691 9.36e-25 SMART
CA 717 798 9.9e-15 SMART
transmembrane domain 830 852 N/A INTRINSIC
low complexity region 876 903 N/A INTRINSIC
low complexity region 951 964 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160721
AA Change: V72A

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124732
Gene: ENSMUSG00000051375
AA Change: V72A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
Pfam:Cadherin_2 36 120 9.9e-10 PFAM
CA 168 256 5.18e-18 SMART
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161701
SMART Domains Protein: ENSMUSP00000125576
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
CA 29 117 5.18e-18 SMART
CA 141 224 5.68e-24 SMART
CA 256 343 1.84e-23 SMART
CA 367 449 2.99e-32 SMART
CA 473 552 9.36e-25 SMART
CA 578 659 9.9e-15 SMART
transmembrane domain 691 713 N/A INTRINSIC
low complexity region 737 764 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 903 914 N/A INTRINSIC
low complexity region 1029 1040 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193828
SMART Domains Protein: ENSMUSP00000142328
Gene: ENSMUSG00000051375

DomainStartEndE-ValueType
low complexity region 18 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194312
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.8%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the protocadherin subfamily within the cadherin superfamily. The encoded protein is a membrane protein found at cell-cell boundaries. It is involved in neural cell adhesion, suggesting a possible role in neuronal development. The protein includes an extracelllular region, containing 7 cadherin-like domains, a transmembrane region and a C-terminal cytoplasmic region. Cells expressing the protein showed cell aggregation activity. Alternative splicing occurs in this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arap3 A T 18: 37,996,895 L71Q probably benign Het
Atp10a A T 7: 58,791,118 K504* probably null Het
AW551984 T C 9: 39,592,979 T564A probably benign Het
Cep128 A G 12: 91,299,034 V268A probably benign Het
Clgn T C 8: 83,423,124 M418T probably damaging Het
Col12a1 A G 9: 79,651,380 probably null Het
Col4a3 A T 1: 82,682,761 E933D unknown Het
Csmd1 A T 8: 16,070,313 L1826Q probably damaging Het
Enpp2 C T 15: 54,844,378 probably null Het
Ep400 G A 5: 110,693,171 R1832* probably null Het
Exoc5 T C 14: 49,048,765 K135R probably benign Het
Fam83h A G 15: 76,001,897 F1197S probably damaging Het
Gabrg1 T C 5: 70,782,280 I170V probably benign Het
Gigyf2 C T 1: 87,419,106 R610C unknown Het
Gm16440 T C 14: 6,388,301 E119G probably benign Het
Gm17669 A G 18: 67,562,438 R18G probably damaging Het
Gxylt1 A G 15: 93,261,827 S100P probably damaging Het
Hacd4 C G 4: 88,398,105 R259T unknown Het
Hacd4 T A 4: 88,398,106 R259* probably null Het
Hist1h3h C A 13: 21,717,919 S87R possibly damaging Het
Hivep3 T C 4: 120,099,182 L1565P probably damaging Het
Iqsec1 T A 6: 90,690,489 D218V probably damaging Het
Matn2 C T 15: 34,428,731 T747I possibly damaging Het
Myl6b T A 10: 128,496,306 Q97L possibly damaging Het
Olfr73 A T 2: 88,034,782 M119K probably damaging Het
Pira2 C T 7: 3,842,170 S363N probably benign Het
Pira2 G C 7: 3,842,173 T362S probably benign Het
Pira2 T C 7: 3,842,174 T362A probably benign Het
Pkhd1 A G 1: 20,222,906 V2830A possibly damaging Het
Plpp1 A G 13: 112,856,885 D118G probably damaging Het
Polr2a A G 11: 69,735,967 S1514P possibly damaging Het
Pou3f2 G T 4: 22,487,291 Q281K possibly damaging Het
Prl7a2 A T 13: 27,659,276 Y181* probably null Het
Prpf4b T A 13: 34,884,291 S368T probably benign Het
Prss45 A G 9: 110,838,445 D53G probably benign Het
Ryr2 T A 13: 11,594,755 H4395L possibly damaging Het
Spp2 G T 1: 88,411,205 A97S probably benign Het
Strn4 T C 7: 16,822,509 F99S probably damaging Het
Tcaf2 T A 6: 42,642,805 H96L probably damaging Het
Tenm2 T C 11: 36,163,730 D601G probably damaging Het
Trpm6 A T 19: 18,825,802 M870L possibly damaging Het
Ttn T C 2: 76,943,225 T2351A unknown Het
Xirp2 T A 2: 67,511,597 I1394K possibly damaging Het
Zfc3h1 G T 10: 115,390,889 D284Y probably damaging Het
Other mutations in Pcdh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:Pcdh1 APN 18 38198729 missense possibly damaging 0.65
IGL00919:Pcdh1 APN 18 38202812 nonsense probably null
IGL01744:Pcdh1 APN 18 38203249 missense probably damaging 1.00
R0542:Pcdh1 UTSW 18 38189922 missense probably damaging 0.99
R1449:Pcdh1 UTSW 18 38189876 missense probably damaging 0.99
R1540:Pcdh1 UTSW 18 38189726 missense probably benign 0.01
R1642:Pcdh1 UTSW 18 38199230 missense possibly damaging 0.84
R1672:Pcdh1 UTSW 18 38192180 missense probably damaging 1.00
R1695:Pcdh1 UTSW 18 38202868 missense probably damaging 1.00
R1727:Pcdh1 UTSW 18 38203032 nonsense probably null
R1781:Pcdh1 UTSW 18 38189924 missense probably damaging 1.00
R1793:Pcdh1 UTSW 18 38198885 missense probably damaging 0.99
R1839:Pcdh1 UTSW 18 38199485 missense possibly damaging 0.82
R1843:Pcdh1 UTSW 18 38192225 unclassified probably null
R1882:Pcdh1 UTSW 18 38202842 missense possibly damaging 0.49
R2261:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2262:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2263:Pcdh1 UTSW 18 38198657 missense probably benign 0.01
R2511:Pcdh1 UTSW 18 38199479 missense possibly damaging 0.95
R2937:Pcdh1 UTSW 18 38189762 missense probably benign 0.40
R3941:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R3942:Pcdh1 UTSW 18 38199458 missense probably benign 0.02
R4057:Pcdh1 UTSW 18 38198897 missense probably damaging 0.98
R4155:Pcdh1 UTSW 18 38203106 missense probably damaging 0.99
R4169:Pcdh1 UTSW 18 38198305 missense probably damaging 1.00
R4617:Pcdh1 UTSW 18 38197860 missense probably benign 0.00
R4690:Pcdh1 UTSW 18 38203475 missense probably benign 0.33
R4825:Pcdh1 UTSW 18 38189859 missense possibly damaging 0.77
R5201:Pcdh1 UTSW 18 38198918 missense probably damaging 0.98
R5266:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5267:Pcdh1 UTSW 18 38192199 missense probably damaging 1.00
R5351:Pcdh1 UTSW 18 38197766 missense probably damaging 1.00
R5568:Pcdh1 UTSW 18 38197367 missense probably damaging 1.00
R5729:Pcdh1 UTSW 18 38202946 missense probably damaging 1.00
R5731:Pcdh1 UTSW 18 38198598 missense probably damaging 1.00
R6043:Pcdh1 UTSW 18 38203274 missense probably damaging 0.97
R6278:Pcdh1 UTSW 18 38199210 missense probably benign 0.29
R6333:Pcdh1 UTSW 18 38198807 missense probably benign 0.25
R6498:Pcdh1 UTSW 18 38197437 missense probably benign 0.18
R6937:Pcdh1 UTSW 18 38203475 missense possibly damaging 0.86
R6994:Pcdh1 UTSW 18 38198500 missense probably damaging 1.00
R7242:Pcdh1 UTSW 18 38203217 missense probably benign 0.06
R7289:Pcdh1 UTSW 18 38189913 missense probably damaging 0.99
R7391:Pcdh1 UTSW 18 38202785 missense possibly damaging 0.95
X0027:Pcdh1 UTSW 18 38189788 nonsense probably null
Z1088:Pcdh1 UTSW 18 38198067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTATCTGGCCCTCTAGCAG -3'
(R):5'- GTTCTCCTGATTCTGGAGCC -3'

Sequencing Primer
(F):5'- CCTCTAGCAGCCGGGGG -3'
(R):5'- TGGAGCCTGCCAGGATG -3'
Posted On2019-06-07