Incidental Mutation 'PIT4305001:Ltn1'
ID554584
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4305001 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87420323 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 342 (P342L)
Ref Sequence ENSEMBL: ENSMUSP00000038775 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably damaging
Transcript: ENSMUST00000039449
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: P342L

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232095
AA Change: P342L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.3%
  • 10x: 86.8%
  • 20x: 76.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,259,041 N801D probably benign Het
Adcy2 T C 13: 68,678,602 K661R probably benign Het
Akap1 A T 11: 88,844,378 M486K probably benign Het
Arhgap40 T A 2: 158,531,905 I202N probably benign Het
C1qtnf2 T A 11: 43,491,195 L248Q probably damaging Het
Casp1 A T 9: 5,306,135 H340L probably benign Het
Cd5 A G 19: 10,726,386 V104A possibly damaging Het
Celsr1 T A 15: 85,900,937 E3032V possibly damaging Het
Cts7 A G 13: 61,356,572 I59T probably damaging Het
Cutc G T 19: 43,768,269 A267S probably damaging Het
Dmwd A G 7: 19,080,718 Q431R probably damaging Het
Dnah6 T C 6: 73,065,755 N3280S probably benign Het
Dnah7b A T 1: 46,373,348 N4039I probably damaging Het
Dnaja4 T C 9: 54,710,634 I260T probably benign Het
Drd5 T C 5: 38,320,584 F307L probably damaging Het
Dsc2 C T 18: 20,046,243 S256N probably damaging Het
Dstyk G T 1: 132,455,896 E617* probably null Het
Dusp15 G A 2: 152,945,476 H72Y probably benign Het
Dysf C T 6: 84,100,234 R660* probably null Het
Fbxl13 T A 5: 21,522,148 I584L probably benign Het
Gm10354 T C 5: 14,978,790 D29G probably benign Het
Gsap T C 5: 21,186,409 L16P probably damaging Het
Hgsnat C T 8: 25,945,199 A636T possibly damaging Het
Hivep1 A G 13: 42,181,671 T161A Het
Hspg2 T C 4: 137,550,373 S2928P possibly damaging Het
Ifi214 G A 1: 173,527,919 P108S probably benign Het
Il17ra A T 6: 120,481,406 Y506F probably damaging Het
Il9r T A 11: 32,194,734 Q53L probably benign Het
Irf2bp2 C T 8: 126,592,659 G260R probably damaging Het
Jdp2 T A 12: 85,638,852 I129N probably damaging Het
Kif1b T C 4: 149,220,792 probably null Het
Klrd1 A G 6: 129,596,707 T120A unknown Het
Lfng A G 5: 140,612,528 N202D probably damaging Het
Ltbp3 A G 19: 5,752,067 E757G probably damaging Het
Lum A C 10: 97,568,876 Y211S probably damaging Het
Ncapd2 G A 6: 125,184,027 R292* probably null Het
Nlrc4 T C 17: 74,446,309 T360A probably damaging Het
Olfr1231 T C 2: 89,303,383 I70V probably benign Het
Olfr850 T C 9: 19,478,061 Y63C probably damaging Het
Palm2 C A 4: 57,638,029 T22K possibly damaging Het
Pde3a A G 6: 141,492,310 D1035G probably benign Het
Phf20l1 A T 15: 66,613,052 K322I possibly damaging Het
Pik3r3 A C 4: 116,292,126 N349T probably benign Het
Poc1a A G 9: 106,349,829 Q420R Het
Prl7d1 A T 13: 27,714,337 M63K possibly damaging Het
Rap1gds1 C A 3: 138,956,300 M398I probably benign Het
Rapgef6 T A 11: 54,679,377 V1192D probably damaging Het
Rif1 T C 2: 52,111,958 V166A Het
Robo4 T C 9: 37,411,391 Y847H probably damaging Het
Sardh T C 2: 27,228,314 N468S probably damaging Het
Sema5a A G 15: 32,628,199 T553A probably benign Het
Serpina12 A G 12: 104,035,717 Y247H probably damaging Het
Ston2 G T 12: 91,648,502 D377E possibly damaging Het
Syne1 A G 10: 5,333,023 S1557P probably damaging Het
Syt6 C T 3: 103,575,453 R26W possibly damaging Het
Tep1 C T 14: 50,829,227 G2305R possibly damaging Het
Ticrr A G 7: 79,679,023 T637A possibly damaging Het
Tnn A T 1: 160,086,077 F1546Y possibly damaging Het
Tpr A G 1: 150,440,137 D2055G possibly damaging Het
Trim39 A G 17: 36,268,970 V31A possibly damaging Het
Trpc7 G T 13: 56,887,508 T204K probably benign Het
Urgcp T C 11: 5,717,996 Y157C probably damaging Het
Vmn1r81 A T 7: 12,260,663 I6K probably benign Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAAATGTATTTGCTCACCCGG -3'
(R):5'- TGTCCTGTCTAATAAAACTCACTGG -3'

Sequencing Primer
(F):5'- TTTGCTCACCCGGTAACTAGAGAG -3'
(R):5'- GAACTCTGTACCTTCGGAAGTCAG -3'
Posted On2019-06-07