Incidental Mutation 'PIT4362001:Polr1b'
ID554602
Institutional Source Beutler Lab
Gene Symbol Polr1b
Ensembl Gene ENSMUSG00000027395
Gene Namepolymerase (RNA) I polypeptide B
Synonyms128kDa, RPA116, RPA2, D630020H17Rik, Rpo1-2
Accession Numbers

Ncbi RefSeq: NM_009086.2; MGI:108014

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4362001 (G1)
Quality Score139.008
Status Not validated
Chromosome2
Chromosomal Location129100995-129126594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 129109292 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 275 (D275G)
Ref Sequence ENSEMBL: ENSMUSP00000099494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028874] [ENSMUST00000103205]
Predicted Effect probably damaging
Transcript: ENSMUST00000028874
AA Change: D275G

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028874
Gene: ENSMUSG00000027395
AA Change: D275G

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 437 4.6e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 8.9e-14 PFAM
Pfam:RNA_pol_Rpb2_3 455 521 1.4e-28 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 3.6e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103205
AA Change: D275G

PolyPhen 2 Score 0.842 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099494
Gene: ENSMUSG00000027395
AA Change: D275G

DomainStartEndE-ValueType
Pfam:RNA_pol_Rpb2_1 37 423 1.7e-35 PFAM
Pfam:RNA_pol_Rpb2_2 186 375 3.2e-11 PFAM
Pfam:RNA_pol_Rpb2_3 455 520 2.1e-29 PFAM
Pfam:RNA_pol_Rpa2_4 563 621 4.1e-23 PFAM
Pfam:RNA_pol_Rpb2_6 670 1031 9.7e-118 PFAM
Pfam:RNA_pol_Rpb2_7 1033 1135 1.2e-22 PFAM
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 91.2%
  • 10x: 87.0%
  • 20x: 78.3%
Validation Efficiency
MGI Phenotype Strain: 3774130
Lethality: E2-E4
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Eukaryotic RNA polymerase I (pol I) is responsible for the transcription of ribosomal RNA (rRNA) genes and production of rRNA, the primary component of ribosomes. Pol I is a multisubunit enzyme composed of 6 to 14 polypeptides, depending on the species. Most of the mass of the pol I complex derives from the 2 largest subunits, Rpa1 and Rpa2 in yeast. POLR1B is homologous to Rpa2 (Seither and Grummt, 1996 [PubMed 8921381]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality prior to implantation. [provided by MGI curators]
Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg1 T C 17: 31,064,424 S28P possibly damaging Het
Akr1c14 T C 13: 4,079,100 V165A probably damaging Het
Aox2 A T 1: 58,282,680 T44S probably damaging Het
Arhgap29 T A 3: 122,003,212 N482K probably benign Het
Arhgef38 T A 3: 133,160,830 D182V Het
Atad5 C T 11: 80,111,567 H1062Y probably benign Het
Atp6v0b A G 4: 117,885,256 S147P possibly damaging Het
Cblb T A 16: 52,139,542 Y299* probably null Het
Ccdc28b T C 4: 129,621,025 N97S probably benign Het
Cdh23 A G 10: 60,465,458 V479A probably benign Het
Chuk A G 19: 44,098,583 probably null Het
Cmtr2 G A 8: 110,222,336 G426D probably damaging Het
Cog4 G A 8: 110,866,672 D472N probably damaging Het
Creb3 T A 4: 43,565,472 L193* probably null Het
Cxcr6 A T 9: 123,810,461 I183F probably benign Het
Dbf4 A G 5: 8,403,664 F253L probably benign Het
Dcaf8 T C 1: 172,172,797 V174A probably damaging Het
Ddhd2 T C 8: 25,735,752 Y526C probably damaging Het
Dnal4 A G 15: 79,763,565 V33A probably benign Het
Egfl7 C T 2: 26,591,040 P188L probably benign Het
Ephb3 A G 16: 21,220,857 E707G probably damaging Het
Epn3 C T 11: 94,496,523 R7H probably damaging Het
Fam198b C A 3: 79,886,939 S238Y possibly damaging Het
Fbp1 T A 13: 62,867,380 I262F probably damaging Het
Fgfbp3 G A 19: 36,918,688 R177* probably null Het
Gbp5 T C 3: 142,500,710 S52P probably damaging Het
Glb1l2 A T 9: 26,773,981 S282T probably benign Het
Glg1 A T 8: 111,258,799 V133E possibly damaging Het
Gm4787 T G 12: 81,377,175 L736F probably benign Het
Gm5565 A T 5: 146,158,299 S212R probably benign Het
Grin2c T C 11: 115,249,633 T1220A probably benign Het
Grp T G 18: 65,886,226 S133A probably benign Het
Gstp2 C A 19: 4,040,713 D147Y possibly damaging Het
Igkv14-130 T C 6: 67,791,408 F84L probably damaging Het
Inppl1 T C 7: 101,826,013 R944G probably benign Het
Lama2 A T 10: 27,369,136 N216K probably damaging Het
Lrp2 T A 2: 69,537,538 D210V probably damaging Het
Lrrc2 A T 9: 110,962,540 Q120L possibly damaging Het
Lrriq1 A G 10: 103,071,194 I1555T probably benign Het
Map2 G A 1: 66,412,518 G189D probably benign Het
Mdc1 A G 17: 35,844,469 E12G possibly damaging Het
Mdga2 T C 12: 66,797,768 D152G possibly damaging Het
Med23 A G 10: 24,874,571 M99V probably benign Het
Mutyh G A 4: 116,817,070 V273M probably damaging Het
Neurod2 T A 11: 98,327,882 Y152F probably damaging Het
Olfr1002 A C 2: 85,647,724 L199R probably damaging Het
Olfr1177-ps C T 2: 88,344,013 A247T probably benign Het
Olfr898 G T 9: 38,349,198 L32F probably benign Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pde6b T C 5: 108,423,585 probably null Het
Pdzrn4 A T 15: 92,769,881 D638V possibly damaging Het
Rnf157 T A 11: 116,360,317 D127V probably damaging Het
Rspo4 T A 2: 151,867,883 C69* probably null Het
Scara3 T C 14: 65,936,402 T63A probably benign Het
Scn2a G A 2: 65,683,838 E289K probably benign Het
Sh3gl2 A G 4: 85,377,549 T163A probably benign Het
Slc2a10 T A 2: 165,516,293 F446Y probably damaging Het
Snapc1 C T 12: 73,982,495 R351C probably damaging Het
Snx6 A G 12: 54,768,030 Y169H possibly damaging Het
Stab2 A T 10: 86,861,435 C1996* probably null Het
Steap4 A G 5: 7,980,337 T398A probably benign Het
Tep1 A T 14: 50,866,053 L260Q probably benign Het
Tspan12 A T 6: 21,835,464 V70D possibly damaging Het
Ttn G A 2: 76,739,018 A27177V probably damaging Het
Ube3a T C 7: 59,276,122 V237A possibly damaging Het
Vil1 G A 1: 74,421,383 R233H probably damaging Het
Xrcc5 A G 1: 72,393,929 T716A probably benign Het
Zbp1 A G 2: 173,216,990 I18T probably damaging Het
Zfp292 A G 4: 34,807,524 V1845A probably benign Het
Zfp407 A T 18: 84,561,268 N573K possibly damaging Het
Zfp64 T C 2: 168,925,815 T626A probably benign Het
Other mutations in Polr1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Polr1b APN 2 129125909 missense probably damaging 1.00
IGL00559:Polr1b APN 2 129113731 missense probably damaging 1.00
IGL00659:Polr1b APN 2 129118100 critical splice donor site probably null
IGL00672:Polr1b APN 2 129125472 missense probably damaging 1.00
IGL01066:Polr1b APN 2 129119152 missense probably damaging 1.00
IGL01536:Polr1b APN 2 129125555 missense probably benign 0.00
IGL01596:Polr1b APN 2 129110126 missense probably benign 0.38
IGL02156:Polr1b APN 2 129123879 missense probably benign 0.40
IGL02398:Polr1b APN 2 129102966 missense probably benign 0.03
IGL02797:Polr1b APN 2 129102979 missense probably damaging 0.99
IGL02965:Polr1b APN 2 129125523 missense probably benign 0.41
IGL03009:Polr1b APN 2 129126068 missense probably damaging 1.00
IGL03092:Polr1b APN 2 129123129 missense probably damaging 1.00
IGL03129:Polr1b APN 2 129115707 missense probably benign 0.00
IGL03138:Polr1b UTSW 2 129102988 missense probably benign 0.04
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0038:Polr1b UTSW 2 129115668 nonsense probably null
R0989:Polr1b UTSW 2 129126077 missense probably damaging 0.97
R1508:Polr1b UTSW 2 129113734 missense probably benign 0.24
R1539:Polr1b UTSW 2 129118099 critical splice donor site probably null
R1700:Polr1b UTSW 2 129123121 missense probably damaging 0.99
R1843:Polr1b UTSW 2 129102966 missense probably benign 0.03
R1920:Polr1b UTSW 2 129101111 missense probably benign 0.00
R2414:Polr1b UTSW 2 129103134 splice site probably benign
R3020:Polr1b UTSW 2 129115681 missense probably benign 0.01
R3837:Polr1b UTSW 2 129119107 missense possibly damaging 0.78
R4466:Polr1b UTSW 2 129123882 missense probably benign 0.03
R4773:Polr1b UTSW 2 129105328 missense probably benign 0.29
R4789:Polr1b UTSW 2 129109337 missense probably benign 0.00
R5027:Polr1b UTSW 2 129123883 missense possibly damaging 0.94
R5579:Polr1b UTSW 2 129110108 missense probably damaging 1.00
R5705:Polr1b UTSW 2 129105351 nonsense probably null
R6303:Polr1b UTSW 2 129115762 missense probably damaging 1.00
R6313:Polr1b UTSW 2 129125446 missense probably damaging 1.00
R6427:Polr1b UTSW 2 129123261 missense probably damaging 0.99
R6677:Polr1b UTSW 2 129120211 intron probably benign
R7033:Polr1b UTSW 2 129115642 missense possibly damaging 0.82
R7163:Polr1b UTSW 2 129126011 missense probably benign 0.44
R7184:Polr1b UTSW 2 129123922 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GGCATTAAGGTTATGAGAGGCTC -3'
(R):5'- ACATACTTAAGCAGGAACTCGG -3'

Sequencing Primer
(F):5'- TTATGAGAGGCTCAGTGCAGC -3'
(R):5'- TAAGCAGGAACTCGGCAGCTTC -3'
Posted On2019-06-07