Incidental Mutation 'PIT4382001:Pogz'
ID554669
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Namepogo transposable element with ZNF domain
Synonyms9530006B08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #PIT4382001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94837567-94882326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94879796 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1232 (S1232T)
Ref Sequence ENSEMBL: ENSMUSP00000102891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005923] [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
Predicted Effect probably benign
Transcript: ENSMUST00000005923
SMART Domains Protein: ENSMUSP00000005923
Gene: ENSMUSG00000005779

DomainStartEndE-ValueType
Pfam:Proteasome 50 237 3.1e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000042402
AA Change: S1223T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: S1223T

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107266
AA Change: S1179T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: S1179T

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107269
AA Change: S1137T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: S1137T

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107270
AA Change: S1232T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: S1232T

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
FR4976:Pogz UTSW 3 94874695 unclassified probably benign
PIT4434001:Pogz UTSW 3 94872370 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1670:Pogz UTSW 3 94878849 missense probably benign 0.21
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1855:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R6104:Pogz UTSW 3 94880031 missense probably benign 0.09
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTCTTCCGAGGACAAGCG -3'
(R):5'- TGAACTAGCTCTGGGGAGTC -3'

Sequencing Primer
(F):5'- TCTTCCGAGGACAAGCGAATCG -3'
(R):5'- GCTGAAGCAAGACATCAGAATC -3'
Posted On2019-06-07