Incidental Mutation 'PIT4382001:Nsun5'
ID554676
Institutional Source Beutler Lab
Gene Symbol Nsun5
Ensembl Gene ENSMUSG00000000916
Gene NameNOL1/NOP2/Sun domain family, member 5
Synonyms9830109N13Rik, Nol1r, Wbscr20a
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4382001 (G1)
Quality Score197.009
Status Not validated
Chromosome5
Chromosomal Location135369953-135376805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135371501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 132 (Y132C)
Ref Sequence ENSEMBL: ENSMUSP00000000940 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000940] [ENSMUST00000065785] [ENSMUST00000111171] [ENSMUST00000111180] [ENSMUST00000170342]
Predicted Effect probably benign
Transcript: ENSMUST00000000940
AA Change: Y132C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000000940
Gene: ENSMUSG00000000916
AA Change: Y132C

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 78 90 N/A INTRINSIC
low complexity region 180 189 N/A INTRINSIC
Pfam:Nol1_Nop2_Fmu 219 423 1.1e-32 PFAM
low complexity region 448 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065785
SMART Domains Protein: ENSMUSP00000066662
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 292 344 1.07e-13 SMART
SPRY 345 473 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111171
SMART Domains Protein: ENSMUSP00000106801
Gene: ENSMUSG00000053293

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
low complexity region 147 165 N/A INTRINSIC
low complexity region 174 188 N/A INTRINSIC
Pfam:POM121 292 527 1.3e-111 PFAM
low complexity region 541 551 N/A INTRINSIC
low complexity region 552 576 N/A INTRINSIC
low complexity region 581 602 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 658 674 N/A INTRINSIC
low complexity region 681 699 N/A INTRINSIC
low complexity region 715 742 N/A INTRINSIC
low complexity region 767 776 N/A INTRINSIC
low complexity region 782 800 N/A INTRINSIC
low complexity region 809 825 N/A INTRINSIC
internal_repeat_4 827 861 8.15e-5 PROSPERO
low complexity region 874 904 N/A INTRINSIC
internal_repeat_3 905 952 5.01e-5 PROSPERO
internal_repeat_1 917 961 1.66e-6 PROSPERO
low complexity region 963 979 N/A INTRINSIC
low complexity region 1002 1048 N/A INTRINSIC
low complexity region 1050 1099 N/A INTRINSIC
internal_repeat_2 1104 1144 4.39e-6 PROSPERO
internal_repeat_1 1114 1155 1.66e-6 PROSPERO
internal_repeat_4 1125 1164 8.15e-5 PROSPERO
internal_repeat_3 1126 1175 5.01e-5 PROSPERO
internal_repeat_2 1142 1178 4.39e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000111180
SMART Domains Protein: ENSMUSP00000106811
Gene: ENSMUSG00000053388

DomainStartEndE-ValueType
RING 16 56 7.92e-8 SMART
BBOX 84 125 3.34e-6 SMART
coiled coil region 128 163 N/A INTRINSIC
coiled coil region 206 235 N/A INTRINSIC
PRY 293 345 1.07e-13 SMART
SPRY 346 474 7.48e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170342
SMART Domains Protein: ENSMUSP00000128370
Gene: ENSMUSG00000000916

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 76 91 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202422
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of an evolutionarily conserved family of proteins that may function as methyltransferases. This gene is located in a larger region of chromosome 7 that is deleted in Williams-Beuren syndrome, a multisystem developmental disorder. There are two pseudogenes for this gene located in the same region of chromosome 7. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Nsun5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Nsun5 APN 5 135375395 missense possibly damaging 0.69
IGL01797:Nsun5 APN 5 135375371 missense probably damaging 1.00
IGL01817:Nsun5 APN 5 135370039 missense probably damaging 1.00
IGL03233:Nsun5 APN 5 135375445 missense probably damaging 1.00
R1436:Nsun5 UTSW 5 135370213 missense probably damaging 1.00
R1710:Nsun5 UTSW 5 135371316 missense probably damaging 1.00
R1919:Nsun5 UTSW 5 135375598 missense probably benign 0.00
R2067:Nsun5 UTSW 5 135375072 missense probably damaging 1.00
R2937:Nsun5 UTSW 5 135375463 nonsense probably null
R2938:Nsun5 UTSW 5 135375463 nonsense probably null
R4277:Nsun5 UTSW 5 135370060 missense probably damaging 1.00
R4278:Nsun5 UTSW 5 135370060 missense probably damaging 1.00
R5732:Nsun5 UTSW 5 135371350 missense probably damaging 1.00
R6261:Nsun5 UTSW 5 135371531 missense probably damaging 1.00
R6525:Nsun5 UTSW 5 135375058 missense probably damaging 1.00
R6922:Nsun5 UTSW 5 135370192 missense probably damaging 0.98
R7110:Nsun5 UTSW 5 135371250 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCCAGGTGCTAGTGTATG -3'
(R):5'- ACTTCCTTGAGAACCTGGACAC -3'

Sequencing Primer
(F):5'- CGATGGAAGGCTCTGCTG -3'
(R):5'- CACAGAGGAAAATGAAGGCACCC -3'
Posted On2019-06-07