Incidental Mutation 'PIT4382001:Il17re'
ID554681
Institutional Source Beutler Lab
Gene Symbol Il17re
Ensembl Gene ENSMUSG00000043088
Gene Nameinterleukin 17 receptor E
SynonymsIl25r
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4382001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location113458484-113470758 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 113469077 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 426 (T426A)
Ref Sequence ENSEMBL: ENSMUSP00000062103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053569] [ENSMUST00000058300] [ENSMUST00000058548] [ENSMUST00000101065] [ENSMUST00000203281] [ENSMUST00000203661] [ENSMUST00000204774]
Predicted Effect probably benign
Transcript: ENSMUST00000053569
AA Change: T225A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054378
Gene: ENSMUSG00000043088
AA Change: T225A

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058300
SMART Domains Protein: ENSMUSP00000055343
Gene: ENSMUSG00000030281

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:IL17_R_N 71 190 2.8e-45 PFAM
Pfam:IL17_R_N 189 432 1.3e-93 PFAM
transmembrane domain 441 460 N/A INTRINSIC
Pfam:SEFIR 473 623 7.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058548
AA Change: T426A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000062103
Gene: ENSMUSG00000043088
AA Change: T426A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 6.2e-121 PFAM
transmembrane domain 415 437 N/A INTRINSIC
Pfam:SEFIR 448 585 1.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101065
AA Change: T225A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098626
Gene: ENSMUSG00000043088
AA Change: T225A

DomainStartEndE-ValueType
Pfam:IL17_R_N 1 207 8.2e-109 PFAM
transmembrane domain 214 236 N/A INTRINSIC
Pfam:SEFIR 247 384 8.5e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203281
SMART Domains Protein: ENSMUSP00000145363
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203661
SMART Domains Protein: ENSMUSP00000145345
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
Pfam:SEFIR 403 539 1.6e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204447
Predicted Effect probably benign
Transcript: ENSMUST00000204774
SMART Domains Protein: ENSMUSP00000145384
Gene: ENSMUSG00000043088

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:IL17_R_N 26 408 5.6e-121 PFAM
low complexity region 417 426 N/A INTRINSIC
Pfam:SEFIR 428 565 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205208
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein that functions as the receptor for interleukin-17C. The encoded protein signals to downstream components of the mitogen activated protein kinase (MAPK) pathway. Activity of this protein is important in the immune response to bacterial pathogens. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Homozygous mice exhibit increased susceptibility to DSS-induced colitis, imiquimod-induced psoriasis, and C. rodentium bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Csad G A 15: 102,188,650 L7F probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Il17re
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Il17re APN 6 113469599 missense probably damaging 0.99
IGL01568:Il17re APN 6 113470052 missense probably damaging 1.00
IGL01656:Il17re APN 6 113462973 splice site probably benign
IGL01994:Il17re APN 6 113468450 missense probably benign 0.13
IGL02261:Il17re APN 6 113468511 unclassified probably benign
IGL02699:Il17re APN 6 113468919 missense probably damaging 1.00
R0195:Il17re UTSW 6 113466137 missense probably damaging 1.00
R1901:Il17re UTSW 6 113469704 missense probably damaging 0.98
R2232:Il17re UTSW 6 113464800 missense probably damaging 1.00
R2357:Il17re UTSW 6 113468470 missense possibly damaging 0.55
R2393:Il17re UTSW 6 113462353 missense possibly damaging 0.91
R2916:Il17re UTSW 6 113466028 critical splice donor site probably null
R4820:Il17re UTSW 6 113465855 missense probably benign 0.08
R4951:Il17re UTSW 6 113468907 missense probably damaging 1.00
R4974:Il17re UTSW 6 113469569 missense probably benign 0.14
R5070:Il17re UTSW 6 113459010 missense probably damaging 0.97
R5166:Il17re UTSW 6 113462962 missense probably benign 0.00
R5404:Il17re UTSW 6 113469102 missense probably benign 0.00
R5810:Il17re UTSW 6 113469596 missense probably damaging 1.00
R5916:Il17re UTSW 6 113470123 missense probably damaging 1.00
R6048:Il17re UTSW 6 113470108 missense possibly damaging 0.95
R7432:Il17re UTSW 6 113462371 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ACGCTAGCTCACATGAGTGG -3'
(R):5'- TAAATAGCCCTGTCGTCCCC -3'

Sequencing Primer
(F):5'- TCACATGAGTGGGGCCCTG -3'
(R):5'- ACACCGCCTTTTGCAGCAG -3'
Posted On2019-06-07