Incidental Mutation 'PIT4382001:Csad'
ID554717
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4382001 (G1)
Quality Score154.008
Status Not validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 102188650 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 7 (L7F)
Ref Sequence ENSEMBL: ENSMUSP00000023805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000229043] [ENSMUST00000229252] [ENSMUST00000229345] [ENSMUST00000229470] [ENSMUST00000229514] [ENSMUST00000229770] [ENSMUST00000229938] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230656] [ENSMUST00000230687] [ENSMUST00000230708] [ENSMUST00000231030] [ENSMUST00000231048]
Predicted Effect probably benign
Transcript: ENSMUST00000023805
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: L7F

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229043
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229252
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229345
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229470
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229514
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229770
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000229938
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000230288
AA Change: L7F

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000230322
AA Change: L7F

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230656
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000230687
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect probably benign
Transcript: ENSMUST00000231030
AA Change: L7F

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000231048
AA Change: L7F

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.5%
  • 10x: 84.6%
  • 20x: 72.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik G T 7: 137,376,982 H144N unknown Het
Acsm4 C T 7: 119,698,575 T145M probably damaging Het
Adam10 T C 9: 70,766,081 L498P probably damaging Het
Adgrl2 A G 3: 148,817,298 L430P Het
Alk T C 17: 71,949,921 M648V probably benign Het
Arhgap35 T C 7: 16,563,869 R424G possibly damaging Het
Baiap2l1 T C 5: 144,278,670 K342E possibly damaging Het
Ccdc54 C T 16: 50,590,856 V16M probably damaging Het
Chil3 T G 3: 106,148,659 D366A probably damaging Het
Chuk A G 19: 44,098,607 V151A probably damaging Het
Cpd T G 11: 76,797,788 H886P probably benign Het
Cped1 T A 6: 22,222,450 C736* probably null Het
Creb3l3 T C 10: 81,084,912 E428G probably benign Het
Dnah1 C T 14: 31,284,455 D2255N probably damaging Het
Dnajb12 T C 10: 59,892,686 Y159H probably damaging Het
Dpysl4 T A 7: 139,089,578 Y57* probably null Het
F2rl1 T G 13: 95,513,646 N243H probably benign Het
Fhl4 T C 10: 85,098,429 K163E possibly damaging Het
Flot2 T C 11: 78,053,367 S46P possibly damaging Het
Fsip2 C A 2: 82,990,852 T5643K possibly damaging Het
Gm853 A T 4: 130,219,161 N147K possibly damaging Het
Gm8765 A T 13: 50,700,971 E215V probably damaging Het
Golga4 T A 9: 118,553,453 Y542N possibly damaging Het
Il17re A G 6: 113,469,077 T426A probably benign Het
Kdm2a T A 19: 4,343,173 M385L probably benign Het
Kdm3b T C 18: 34,809,087 S744P probably damaging Het
Krtap6-3 T A 16: 89,084,160 Y26* probably null Het
Lama2 T C 10: 27,204,905 D974G probably damaging Het
Lipo5 A T 19: 33,465,939 L159Q probably null Het
Mau2 C T 8: 70,030,652 E187K possibly damaging Het
Mrpl9 T C 3: 94,447,829 L236P probably benign Het
Mta1 A G 12: 113,133,250 T564A probably benign Het
Mylk C T 16: 34,875,642 S249L probably damaging Het
Ncor1 G T 11: 62,344,663 T331K probably damaging Het
Nsun3 T A 16: 62,785,865 K15N probably damaging Het
Nsun5 A G 5: 135,371,501 Y132C probably benign Het
Obsl1 T A 1: 75,487,963 T1605S probably benign Het
Olfr1463 T C 19: 13,234,895 I215T probably damaging Het
Olfr519 A G 7: 108,894,102 Y107H probably damaging Het
Olfr566 A G 7: 102,856,602 Y227H probably damaging Het
Olfr574 A T 7: 102,949,449 Y328F probably benign Het
Oraov1 T A 7: 144,916,444 Y37N probably damaging Het
P2rx1 A G 11: 73,009,200 N148D probably benign Het
Pogz T A 3: 94,879,796 S1232T probably damaging Het
Polr3b C A 10: 84,684,185 T655N probably damaging Het
Prss34 T C 17: 25,298,908 probably null Het
Rhpn2 A G 7: 35,390,753 probably null Het
Runx1 T A 16: 92,613,760 D256V probably damaging Het
Shc1 C A 3: 89,427,408 Q525K probably benign Het
Slc10a5 T C 3: 10,335,447 D51G probably benign Het
Slc6a3 A T 13: 73,571,523 N557I probably benign Het
Slmap C T 14: 26,533,431 R32H probably damaging Het
Spata31d1c T C 13: 65,036,171 I509T probably benign Het
Srr C A 11: 74,910,308 V138F probably benign Het
Tas2r118 G A 6: 23,969,786 T92I possibly damaging Het
Tcaf2 A T 6: 42,624,366 *920K probably null Het
Tenm2 T A 11: 36,063,902 Y1141F probably damaging Het
Thoc6 T C 17: 23,668,867 N322S probably benign Het
Tlcd2 A G 11: 75,468,591 I70V probably benign Het
Tmem214 A G 5: 30,871,451 D128G possibly damaging Het
Trav13-4-dv7 T C 14: 53,757,781 V64A probably benign Het
Tyro3 T C 2: 119,802,364 W122R probably damaging Het
Ugcg A G 4: 59,213,246 D144G possibly damaging Het
Uimc1 T C 13: 55,031,015 D627G probably benign Het
Utp6 T C 11: 79,962,273 I13V probably benign Het
Vmn2r99 A G 17: 19,394,343 K775R probably damaging Het
Wdfy3 CG C 5: 101,882,961 probably null Het
Zw10 C T 9: 49,071,644 T525I probably benign Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
R0701:Csad UTSW 15 102179136 missense probably benign 0.42
R1595:Csad UTSW 15 102177782 missense probably damaging 1.00
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R2928:Csad UTSW 15 102177704 missense probably damaging 1.00
R3924:Csad UTSW 15 102178556 missense probably benign 0.05
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R6418:Csad UTSW 15 102179523 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCCGGATGTCTTCACAAGTG -3'
(R):5'- ACCATCTCCTCGGATACTGC -3'

Sequencing Primer
(F):5'- GATGTCTTCACAAGTGTGTCCAAGC -3'
(R):5'- GGATACTGCCACTGCCCTAATG -3'
Posted On2019-06-07