Incidental Mutation 'PIT4366001:Cpne9'
ID554761
Institutional Source Beutler Lab
Gene Symbol Cpne9
Ensembl Gene ENSMUSG00000030270
Gene Namecopine family member IX
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.237) question?
Stock #PIT4366001 (G1)
Quality Score169.009
Status Not validated
Chromosome6
Chromosomal Location113282307-113305627 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113294746 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 356 (G356W)
Ref Sequence ENSEMBL: ENSMUSP00000044416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000130191]
Predicted Effect probably damaging
Transcript: ENSMUST00000041203
AA Change: G356W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270
AA Change: G356W

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130191
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.5%
  • 20x: 73.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk C A 11: 120,010,960 S870I possibly damaging Het
Abca13 T C 11: 9,294,962 V2275A probably benign Het
Abcb5 T C 12: 118,936,098 K278R probably damaging Het
Adcy2 TA TAA 13: 68,709,990 probably benign Het
Add3 C T 19: 53,216,867 P16L unknown Het
Akap9 T A 5: 4,046,221 D2365E probably benign Het
Asah1 A G 8: 41,343,746 S300P possibly damaging Het
Astn1 A T 1: 158,597,209 H655L probably benign Het
Astn1 A T 1: 158,597,211 I656F probably benign Het
Bmpr1b T A 3: 141,880,463 T13S probably benign Het
Camsap2 A G 1: 136,280,317 F478L Het
Card10 G A 15: 78,787,431 S611L probably benign Het
Cep68 T C 11: 20,240,007 N335S probably benign Het
Chac1 T C 2: 119,351,505 W35R probably damaging Het
Cntn6 T C 6: 104,832,537 V511A probably benign Het
Dnah10 C A 5: 124,775,524 T1939K possibly damaging Het
Dock10 T C 1: 80,595,721 N239D probably benign Het
Dock5 T C 14: 67,824,674 K415R possibly damaging Het
Dtd2 C A 12: 51,999,799 D86Y probably damaging Het
Efcab9 A G 11: 32,523,608 F127S probably damaging Het
Ermp1 T C 19: 29,628,789 H375R probably benign Het
Frem2 A T 3: 53,653,201 M1295K probably damaging Het
Gbp7 T G 3: 142,542,951 I325R probably benign Het
Gpr179 T C 11: 97,336,851 K1493E probably benign Het
Gucy2g T A 19: 55,237,782 E234V probably null Het
Itpr1 T A 6: 108,493,757 C2215* probably null Het
Ltn1 G A 16: 87,380,840 R1634* probably null Het
Lynx1 A T 15: 74,751,409 M58K possibly damaging Het
Macc1 T C 12: 119,446,949 V484A probably benign Het
Map3k9 C T 12: 81,772,761 V240M possibly damaging Het
Marc1 A G 1: 184,807,186 F96S probably benign Het
Mars A G 10: 127,299,398 M608T possibly damaging Het
Mc2r T C 18: 68,407,755 M156V probably benign Het
Mchr1 G T 15: 81,237,216 V56L probably benign Het
Mlxip C T 5: 123,395,110 P61S probably benign Het
Muc4 A G 16: 32,754,796 T1557A unknown Het
Myt1 T C 2: 181,825,938 V1135A probably damaging Het
Ndufaf6 A T 4: 11,073,215 S76T probably benign Het
Ntrk2 A G 13: 59,060,335 Y665C probably damaging Het
Oaz3 T G 3: 94,433,594 R215S unknown Het
Olfr1022 T C 2: 85,868,882 C97R probably damaging Het
Olfr1031 A T 2: 85,992,041 N75Y probably damaging Het
Olfr1133 C T 2: 87,645,190 W311* probably null Het
Olfr417 T C 1: 174,369,090 Y58H probably damaging Het
Perm1 G T 4: 156,218,735 V579L probably benign Het
Phyhipl A G 10: 70,568,958 V140A probably benign Het
Pip5k1c T A 10: 81,309,008 S228T probably damaging Het
Plekhn1 T G 4: 156,224,811 T213P probably damaging Het
Pomt2 A T 12: 87,116,529 probably null Het
Ptcd1 A G 5: 145,151,335 V622A probably benign Het
Ptn T A 6: 36,741,349 H127L probably benign Het
Ptprk A T 10: 28,586,019 M1193L probably benign Het
Ptpru G A 4: 131,799,712 P650S probably benign Het
Pum2 T A 12: 8,733,390 L613Q probably damaging Het
Rapgef6 A G 11: 54,691,620 T1458A probably damaging Het
Sap130 C T 18: 31,677,409 A470V probably benign Het
Sertad2 C A 11: 20,648,116 P104Q probably benign Het
Sfrp4 A T 13: 19,630,244 M324L unknown Het
Sh3bp4 A G 1: 89,145,434 N668S probably benign Het
Snx30 C A 4: 59,894,653 D410E probably benign Het
Spata31 C A 13: 64,921,505 S489* probably null Het
Taok3 T A 5: 117,227,985 M367K probably benign Het
Tfap2a T C 13: 40,721,374 N254D possibly damaging Het
Tgtp1 T G 11: 48,987,040 L279F possibly damaging Het
Tmpo A G 10: 91,163,310 F205S probably damaging Het
Tmprss5 A T 9: 49,112,217 I218L probably benign Het
Tti2 A G 8: 31,151,196 E116G probably benign Het
Vmn2r59 A T 7: 42,045,781 N402K possibly damaging Het
Other mutations in Cpne9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cpne9 APN 6 113293022 missense possibly damaging 0.54
IGL02318:Cpne9 APN 6 113293738 missense possibly damaging 0.74
IGL02800:Cpne9 APN 6 113302073 missense probably benign 0.40
IGL02819:Cpne9 APN 6 113300663 missense probably damaging 0.99
IGL03111:Cpne9 APN 6 113300610 missense possibly damaging 0.79
R0145:Cpne9 UTSW 6 113300601 missense probably damaging 0.97
R0319:Cpne9 UTSW 6 113294693 missense probably damaging 1.00
R0514:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R0586:Cpne9 UTSW 6 113295063 missense probably damaging 0.96
R0594:Cpne9 UTSW 6 113290400 splice site probably benign
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R4184:Cpne9 UTSW 6 113282457 unclassified probably benign
R4243:Cpne9 UTSW 6 113283023 unclassified probably benign
R4256:Cpne9 UTSW 6 113283023 unclassified probably benign
R4258:Cpne9 UTSW 6 113283023 unclassified probably benign
R4412:Cpne9 UTSW 6 113290001 missense possibly damaging 0.78
R4690:Cpne9 UTSW 6 113302055 missense probably damaging 1.00
R5062:Cpne9 UTSW 6 113304488 missense probably damaging 0.99
R5249:Cpne9 UTSW 6 113293073 splice site probably benign
R5437:Cpne9 UTSW 6 113304630 unclassified probably benign
R5523:Cpne9 UTSW 6 113290231 missense probably damaging 1.00
R5979:Cpne9 UTSW 6 113293749 missense probably benign 0.44
R6207:Cpne9 UTSW 6 113294773 missense possibly damaging 0.88
R6849:Cpne9 UTSW 6 113302118 missense probably damaging 0.98
R6989:Cpne9 UTSW 6 113300583 missense possibly damaging 0.95
R7376:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R7524:Cpne9 UTSW 6 113302064 missense not run
Predicted Primers PCR Primer
(F):5'- CAGGCACAGAATGATGGAGTTC -3'
(R):5'- AAGGTTCAGCTAAGCCCAGC -3'

Sequencing Primer
(F):5'- CACAGAATGATGGAGTTCATGTAGAC -3'
(R):5'- ATCCAGGAGCGCTCTGATC -3'
Posted On2019-06-07