Incidental Mutation 'R0602:Ppp4c'
ID55486
Institutional Source Beutler Lab
Gene Symbol Ppp4c
Ensembl Gene ENSMUSG00000030697
Gene Nameprotein phosphatase 4, catalytic subunit
Synonyms1110002D08Rik, PPX
MMRRC Submission 038791-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0602 (G1)
Quality Score117
Status Validated
Chromosome7
Chromosomal Location126785866-126792496 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 126789082 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032936] [ENSMUST00000094037] [ENSMUST00000172352] [ENSMUST00000205786] [ENSMUST00000205935] [ENSMUST00000206353] [ENSMUST00000206570]
Predicted Effect probably benign
Transcript: ENSMUST00000032936
SMART Domains Protein: ENSMUSP00000032936
Gene: ENSMUSG00000030697

DomainStartEndE-ValueType
PP2Ac 20 290 4.04e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094037
SMART Domains Protein: ENSMUSP00000091579
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 332 348 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172352
SMART Domains Protein: ENSMUSP00000126418
Gene: ENSMUSG00000030699

DomainStartEndE-ValueType
low complexity region 55 75 N/A INTRINSIC
TBOX 90 278 1.79e-128 SMART
low complexity region 333 349 N/A INTRINSIC
low complexity region 415 429 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205862
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205879
Predicted Effect probably benign
Transcript: ENSMUST00000205935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206261
Predicted Effect unknown
Transcript: ENSMUST00000206334
AA Change: S47P
Predicted Effect probably benign
Transcript: ENSMUST00000206353
Predicted Effect probably benign
Transcript: ENSMUST00000206477
Predicted Effect probably benign
Transcript: ENSMUST00000206570
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.7%
Validation Efficiency 95% (58/61)
MGI Phenotype PHENOTYPE: Embryonic Ppp4c-deficiency leads to early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 137,376,361 probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Arih1 A G 9: 59,394,871 probably benign Het
Bcl9 T C 3: 97,205,786 I1118V probably benign Het
Cap1 T C 4: 122,872,409 E12G probably damaging Het
Ccr2 A G 9: 124,106,621 I313V probably benign Het
Cd1d2 T C 3: 86,987,803 S161P probably benign Het
Cd226 C T 18: 89,269,011 T311I probably benign Het
Col25a1 A G 3: 130,575,414 probably null Het
Cspg4 T C 9: 56,888,017 F1012S probably damaging Het
Dnah7b A G 1: 46,324,842 M3541V probably damaging Het
Erbb2 G A 11: 98,434,271 V852M probably damaging Het
Fer1l6 A C 15: 58,577,945 T667P probably damaging Het
Gal3st2c A G 1: 94,009,179 Y282C probably damaging Het
Glp1r T C 17: 30,909,227 L60P probably benign Het
Gm8251 T A 1: 44,059,967 K657I possibly damaging Het
Gtf2h2 A G 13: 100,469,025 V358A probably benign Het
Hephl1 T A 9: 15,089,051 I302F probably damaging Het
Hist2h2aa1 T C 3: 96,245,550 probably benign Het
Lgi2 T C 5: 52,554,423 D185G probably damaging Het
Lrtm1 T C 14: 29,022,222 probably benign Het
Megf10 T G 18: 57,262,100 D511E probably damaging Het
Myo5c A G 9: 75,266,196 probably null Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Ola1 A G 2: 73,093,712 Y368H probably damaging Het
Olfr1497 T C 19: 13,794,662 probably null Het
Olfr1505 A G 19: 13,919,781 T254A probably benign Het
Olfr593 A C 7: 103,212,580 H229P possibly damaging Het
Panx1 A G 9: 15,010,204 L125P probably damaging Het
Pappa2 A G 1: 158,763,055 probably benign Het
Parp6 A G 9: 59,649,365 probably benign Het
Pomgnt2 A G 9: 121,982,273 Y481H probably benign Het
Prl8a8 T A 13: 27,508,550 probably benign Het
Prpf40b C A 15: 99,304,471 A70E unknown Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Ptprc C T 1: 138,089,485 probably benign Het
Rgs22 T C 15: 36,139,872 probably benign Het
Rpgrip1 A G 14: 52,133,856 E344G possibly damaging Het
Sgca A T 11: 94,963,235 I383N possibly damaging Het
Sgms2 T A 3: 131,325,107 probably null Het
Slc9b1 C A 3: 135,397,755 Q549K probably benign Het
Smc4 G C 3: 69,009,538 A187P probably damaging Het
Smco1 A G 16: 32,273,244 S47G probably damaging Het
Sobp T A 10: 43,022,389 E400V probably damaging Het
Stil T A 4: 115,024,423 probably benign Het
Sult3a2 A T 10: 33,782,048 M23K probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcof1 C A 18: 60,833,533 G329W probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Vmn1r171 G T 7: 23,633,177 V276L probably benign Het
Vps13b T C 15: 35,422,368 L158P probably damaging Het
Vps54 A G 11: 21,306,434 I634M possibly damaging Het
Vwa8 T G 14: 79,020,620 S736R probably benign Het
Other mutations in Ppp4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0030:Ppp4c UTSW 7 126788433 missense possibly damaging 0.93
R0601:Ppp4c UTSW 7 126787288 missense probably benign 0.01
R1187:Ppp4c UTSW 7 126786200 missense probably benign 0.02
R1244:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R1346:Ppp4c UTSW 7 126792050 splice site probably benign
R1878:Ppp4c UTSW 7 126787607 missense probably damaging 1.00
R1892:Ppp4c UTSW 7 126786280 missense probably damaging 0.96
R2072:Ppp4c UTSW 7 126787348 critical splice acceptor site probably null
R2313:Ppp4c UTSW 7 126787457 missense probably damaging 0.99
R2863:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R2865:Ppp4c UTSW 7 126792100 missense probably damaging 0.98
R3808:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R3809:Ppp4c UTSW 7 126787327 missense probably damaging 1.00
R4290:Ppp4c UTSW 7 126792059 critical splice donor site probably null
R4504:Ppp4c UTSW 7 126787465 missense probably damaging 1.00
R5001:Ppp4c UTSW 7 126787537 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTATCGAGGCTCACCTGAAGACTG -3'
(R):5'- AGCCTGCTTGGAAGGGCTTAAC -3'

Sequencing Primer
(F):5'- CTCACCTGAAGACTGAGGAGC -3'
(R):5'- GGTGAGAACTTGGACTCTGTC -3'
Posted On2013-07-11