Incidental Mutation 'R0602:Myo5c'
ID55494
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 038791-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0602 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 75266196 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect probably null
Transcript: ENSMUST00000036555
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Meta Mutation Damage Score 0.636 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 99.1%
  • 10x: 97.5%
  • 20x: 94.7%
Validation Efficiency 95% (58/61)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430038I01Rik T C 7: 137,376,361 probably benign Het
A530032D15Rik C G 1: 85,099,505 K113N probably benign Het
Arih1 A G 9: 59,394,871 probably benign Het
Bcl9 T C 3: 97,205,786 I1118V probably benign Het
Cap1 T C 4: 122,872,409 E12G probably damaging Het
Ccr2 A G 9: 124,106,621 I313V probably benign Het
Cd1d2 T C 3: 86,987,803 S161P probably benign Het
Cd226 C T 18: 89,269,011 T311I probably benign Het
Col25a1 A G 3: 130,575,414 probably null Het
Cspg4 T C 9: 56,888,017 F1012S probably damaging Het
Dnah7b A G 1: 46,324,842 M3541V probably damaging Het
Erbb2 G A 11: 98,434,271 V852M probably damaging Het
Fer1l6 A C 15: 58,577,945 T667P probably damaging Het
Gal3st2c A G 1: 94,009,179 Y282C probably damaging Het
Glp1r T C 17: 30,909,227 L60P probably benign Het
Gm8251 T A 1: 44,059,967 K657I possibly damaging Het
Gtf2h2 A G 13: 100,469,025 V358A probably benign Het
Hephl1 T A 9: 15,089,051 I302F probably damaging Het
Hist2h2aa1 T C 3: 96,245,550 probably benign Het
Lgi2 T C 5: 52,554,423 D185G probably damaging Het
Lrtm1 T C 14: 29,022,222 probably benign Het
Megf10 T G 18: 57,262,100 D511E probably damaging Het
Nrbf2 G A 10: 67,267,826 T166M probably damaging Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Ola1 A G 2: 73,093,712 Y368H probably damaging Het
Olfr1497 T C 19: 13,794,662 probably null Het
Olfr1505 A G 19: 13,919,781 T254A probably benign Het
Olfr593 A C 7: 103,212,580 H229P possibly damaging Het
Panx1 A G 9: 15,010,204 L125P probably damaging Het
Pappa2 A G 1: 158,763,055 probably benign Het
Parp6 A G 9: 59,649,365 probably benign Het
Pomgnt2 A G 9: 121,982,273 Y481H probably benign Het
Ppp4c A G 7: 126,789,082 probably benign Het
Prl8a8 T A 13: 27,508,550 probably benign Het
Prpf40b C A 15: 99,304,471 A70E unknown Het
Ptgfr G A 3: 151,835,202 T223M probably damaging Het
Ptprc C T 1: 138,089,485 probably benign Het
Rgs22 T C 15: 36,139,872 probably benign Het
Rpgrip1 A G 14: 52,133,856 E344G possibly damaging Het
Sgca A T 11: 94,963,235 I383N possibly damaging Het
Sgms2 T A 3: 131,325,107 probably null Het
Slc9b1 C A 3: 135,397,755 Q549K probably benign Het
Smc4 G C 3: 69,009,538 A187P probably damaging Het
Smco1 A G 16: 32,273,244 S47G probably damaging Het
Sobp T A 10: 43,022,389 E400V probably damaging Het
Stil T A 4: 115,024,423 probably benign Het
Sult3a2 A T 10: 33,782,048 M23K probably benign Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tcof1 C A 18: 60,833,533 G329W probably damaging Het
Ttc13 A T 8: 124,674,366 S624T probably damaging Het
Vmn1r171 G T 7: 23,633,177 V276L probably benign Het
Vps13b T C 15: 35,422,368 L158P probably damaging Het
Vps54 A G 11: 21,306,434 I634M possibly damaging Het
Vwa8 T G 14: 79,020,620 S736R probably benign Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5440:Myo5c UTSW 9 75258125 missense possibly damaging 0.91
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAAGGTCCTCTGACTTGCAGTGG -3'
(R):5'- CATATCCCTCCAGGAAGTATCTCCCAG -3'

Sequencing Primer
(F):5'- AGCAGATGACCTTGGTGC -3'
(R):5'- CCCCTAATggattacagatgtgtg -3'
Posted On2013-07-11