Incidental Mutation 'PIT4377001:Gdnf'
ID 554949
Institutional Source Beutler Lab
Gene Symbol Gdnf
Ensembl Gene ENSMUSG00000022144
Gene Name glial cell line derived neurotrophic factor
Synonyms glial cell line-derived neurotrophic factor
Accession Numbers
Essential gene? Probably essential (E-score: 0.920) question?
Stock # PIT4377001 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 7840327-7867056 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 7864011 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 141 (R141G)
Ref Sequence ENSEMBL: ENSMUSP00000022744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022744]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000022744
AA Change: R141G

PolyPhen 2 Score 0.359 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000022744
Gene: ENSMUSG00000022144
AA Change: R141G

DomainStartEndE-ValueType
low complexity region 133 146 N/A INTRINSIC
TGFB 147 240 4.36e-3 SMART
Coding Region Coverage
  • 1x: 92.9%
  • 3x: 90.8%
  • 10x: 85.9%
  • 20x: 75.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate each subunit of the disulfide-linked homodimer. The recombinant form of this protein, a highly conserved neurotrophic factor, was shown to promote the survival and differentiation of dopaminergic neurons in culture, and was able to prevent apoptosis of motor neurons induced by axotomy. This protein is a ligand for the product of the RET (rearranged during transfection) protooncogene. Homozygous knockout mice for this gene exhibit defects in kidney development and neonatal death. This gene encodes multiple protein isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to lack of ureteric bud induction, bilateral renal agenesis, absence of enteric neurons, and neonatal death. Heterozygotes show renal phenotypes ranging from two small kidneys, often with abnormal shapes and cortical cysts, to unilateral renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700009N14Rik T C 4: 39,451,129 (GRCm39) C112R possibly damaging Het
Acadl G A 1: 66,877,564 (GRCm39) T329M probably damaging Het
Adgrv1 A G 13: 81,677,104 (GRCm39) L1909P probably damaging Het
Aff3 A C 1: 38,578,044 (GRCm39) V31G probably damaging Het
Bag3 A G 7: 128,147,441 (GRCm39) D352G probably damaging Het
Bcas3 A T 11: 85,386,668 (GRCm39) T368S probably damaging Het
Bmp3 A G 5: 99,027,608 (GRCm39) I434V unknown Het
Casq1 T A 1: 172,039,568 (GRCm39) T336S probably benign Het
Cib2 T G 9: 54,467,271 (GRCm39) E11A probably damaging Het
Cttn C A 7: 143,993,833 (GRCm39) E393D possibly damaging Het
Dchs1 G A 7: 105,406,795 (GRCm39) R2237W probably damaging Het
Dclre1a C T 19: 56,532,837 (GRCm39) A586T probably benign Het
Defb1 C A 8: 22,266,716 (GRCm39) Q17K possibly damaging Het
Dgat2 T C 7: 98,806,342 (GRCm39) Y285C probably damaging Het
Dhx57 A T 17: 80,571,404 (GRCm39) F732Y probably damaging Het
Dock2 T G 11: 34,611,835 (GRCm39) D176A probably benign Het
Epha6 A G 16: 60,025,915 (GRCm39) I509T probably damaging Het
Fblim1 C T 4: 141,322,720 (GRCm39) R21H probably damaging Het
Fbxw20 T A 9: 109,050,795 (GRCm39) H371L probably benign Het
Foxa1 T A 12: 57,589,567 (GRCm39) I218F probably damaging Het
Fstl1 A T 16: 37,636,167 (GRCm39) I53F probably benign Het
Gemin7 G A 7: 19,299,242 (GRCm39) R118* probably null Het
Gm43218 T C 6: 70,217,565 (GRCm39) T64A probably benign Het
Gnat3 G A 5: 18,220,557 (GRCm39) M243I Het
Gramd1a A T 7: 30,843,095 (GRCm39) I71N possibly damaging Het
H4c12 C G 13: 21,934,654 (GRCm39) G8R unknown Het
Htt A T 5: 35,033,309 (GRCm39) D1859V probably benign Het
Hyal1 T C 9: 107,456,468 (GRCm39) F415S probably damaging Het
Ighv1-47 T C 12: 114,954,858 (GRCm39) N74S probably benign Het
Igkv1-131 T C 6: 67,743,192 (GRCm39) R64G probably benign Het
Itgb1 T A 8: 129,436,864 (GRCm39) V95D probably damaging Het
Jak1 A C 4: 101,036,748 (GRCm39) N297K probably benign Het
Kcna4 T A 2: 107,127,205 (GRCm39) N646K possibly damaging Het
Krt42 A G 11: 100,153,931 (GRCm39) S442P probably damaging Het
Mcm3ap G A 10: 76,338,596 (GRCm39) S1408N possibly damaging Het
Mdga2 T A 12: 66,763,469 (GRCm39) Q278L probably damaging Het
Mkln1 C T 6: 31,451,289 (GRCm39) T410M probably damaging Het
Nav3 T C 10: 109,552,466 (GRCm39) E1792G probably damaging Het
Ndrg1 A G 15: 66,820,288 (GRCm39) C49R probably benign Het
Neurl4 A G 11: 69,801,232 (GRCm39) H1201R probably benign Het
Nfasc T C 1: 132,510,804 (GRCm39) Y1073C unknown Het
Nrbp2 A G 15: 75,958,945 (GRCm39) Y253H probably benign Het
Or10c1 T A 17: 37,521,980 (GRCm39) I255F probably benign Het
Or4g16 T A 2: 111,137,225 (GRCm39) V225D probably damaging Het
Or4k45 T C 2: 111,395,556 (GRCm39) T78A probably damaging Het
Pcsk5 A T 19: 17,416,466 (GRCm39) C1661S probably damaging Het
Qsox2 T G 2: 26,110,924 (GRCm39) D147A probably damaging Het
Siglec15 T A 18: 78,100,590 (GRCm39) probably benign Het
Skint5 T A 4: 113,454,900 (GRCm39) T1011S unknown Het
Slc9a2 A G 1: 40,783,001 (GRCm39) T422A probably damaging Het
Tert C T 13: 73,776,380 (GRCm39) T377I possibly damaging Het
Tex15 T A 8: 34,061,129 (GRCm39) S186R probably damaging Het
Tgfb1 A G 7: 25,396,343 (GRCm39) D212G probably benign Het
Tnc T G 4: 63,935,973 (GRCm39) D321A probably damaging Het
Topbp1 G A 9: 103,187,088 (GRCm39) E98K possibly damaging Het
Ugp2 C A 11: 21,320,203 (GRCm39) M1I probably null Het
Vipr2 G A 12: 116,058,418 (GRCm39) D112N probably benign Het
Vps13a T C 19: 16,718,265 (GRCm39) E485G probably damaging Het
Vps37a T A 8: 40,990,087 (GRCm39) I198N possibly damaging Het
Zbtb9 T C 17: 27,193,735 (GRCm39) V380A probably damaging Het
Zfhx4 G C 3: 5,307,802 (GRCm39) V343L probably damaging Het
Other mutations in Gdnf
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1566:Gdnf UTSW 15 7,863,895 (GRCm39) missense probably benign 0.01
R1670:Gdnf UTSW 15 7,845,130 (GRCm39) missense probably benign 0.01
R2915:Gdnf UTSW 15 7,845,130 (GRCm39) missense possibly damaging 0.93
R5395:Gdnf UTSW 15 7,864,165 (GRCm39) missense probably damaging 1.00
R8152:Gdnf UTSW 15 7,864,243 (GRCm39) missense probably damaging 1.00
R8374:Gdnf UTSW 15 7,864,176 (GRCm39) missense probably benign 0.37
R8439:Gdnf UTSW 15 7,864,134 (GRCm39) nonsense probably null
R8491:Gdnf UTSW 15 7,864,272 (GRCm39) missense possibly damaging 0.67
R9492:Gdnf UTSW 15 7,840,423 (GRCm39) start gained probably benign
X0027:Gdnf UTSW 15 7,864,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCGAAATGATCATTGTTG -3'
(R):5'- AGCCTTCTACTCCGAGACAG -3'

Sequencing Primer
(F):5'- TGGACAGCCAATATGCCTG -3'
(R):5'- CCGCTGCAATATCGAAAG -3'
Posted On 2019-06-07