Incidental Mutation 'PIT4378001:Rrbp1'
ID554969
Institutional Source Beutler Lab
Gene Symbol Rrbp1
Ensembl Gene ENSMUSG00000027422
Gene Nameribosome binding protein 1
SynonymsmRRp15b, mRRp47, mRRp41, 5730465C04Rik, 1700087N07Rik, mRRp0, mRRp15a, mRRp16.8, mRRp10, mRRp5.4, ES/130, mRRp2, mRRp1.8, p180
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #PIT4378001 (G1)
Quality Score209.009
Status Not validated
Chromosome2
Chromosomal Location143947395-144011263 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143974540 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 723 (V723A)
Ref Sequence ENSEMBL: ENSMUSP00000016072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016072]
Predicted Effect probably benign
Transcript: ENSMUST00000016072
AA Change: V723A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000016072
Gene: ENSMUSG00000027422
AA Change: V723A

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:Rib_recp_KP_reg 33 171 2.3e-40 PFAM
low complexity region 197 215 N/A INTRINSIC
internal_repeat_2 218 373 2.94e-114 PROSPERO
internal_repeat_1 219 406 7.79e-148 PROSPERO
internal_repeat_1 410 618 7.79e-148 PROSPERO
internal_repeat_2 449 692 2.94e-114 PROSPERO
coiled coil region 757 1126 N/A INTRINSIC
coiled coil region 1167 1321 N/A INTRINSIC
coiled coil region 1342 1455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.1%
  • 3x: 90.8%
  • 10x: 85.0%
  • 20x: 72.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T C 13: 63,015,207 L14P probably damaging Het
2310033P09Rik T C 11: 59,208,976 V100A probably benign Het
9530053A07Rik G A 7: 28,154,464 D1618N possibly damaging Het
Adamtsl1 T C 4: 86,199,364 V188A possibly damaging Het
Aldh6a1 T C 12: 84,441,872 D80G probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Arrdc1 T A 2: 24,926,633 Y177F probably damaging Het
Asap1 C T 15: 64,135,848 R384Q probably damaging Het
Atxn2l A T 7: 126,497,271 V433D probably benign Het
Bbs1 G A 19: 4,891,675 A529V probably benign Het
Bbx G A 16: 50,280,473 R20* probably null Het
Bend5 T C 4: 111,431,107 V106A probably benign Het
C1galt1 A G 6: 7,863,944 N8S probably benign Het
Cdc42ep1 G A 15: 78,849,680 D327N possibly damaging Het
Cep162 A G 9: 87,217,145 S767P probably benign Het
Csmd1 T C 8: 15,895,728 T3562A probably damaging Het
Dnah7a A G 1: 53,531,203 S1815P probably damaging Het
Ei24 A T 9: 36,786,024 L136Q probably damaging Het
Extl2 T G 3: 116,010,690 M1R probably null Het
Fam160a1 A G 3: 85,730,551 L147P probably damaging Het
Fat3 T C 9: 16,376,808 E473G probably benign Het
Fgfr1op T C 17: 8,182,273 S209P probably damaging Het
G6pc3 T A 11: 102,190,001 W26R probably damaging Het
Hc T A 2: 35,031,864 Y610F probably benign Het
Hecw1 T C 13: 14,377,783 D77G probably damaging Het
Hgf T C 5: 16,611,862 V497A probably damaging Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hyou1 A C 9: 44,390,851 D968A probably benign Het
Jmjd1c T A 10: 67,229,913 S1525T probably damaging Het
Kcnc4 G A 3: 107,447,563 T523I probably benign Het
Kcng1 C T 2: 168,262,684 C414Y probably damaging Het
Klhdc10 T C 6: 30,447,412 I204T probably damaging Het
Krt18 A T 15: 102,029,923 T194S probably benign Het
Krt76 A C 15: 101,892,407 N151K probably damaging Het
Krtap31-2 A G 11: 99,936,716 T125A possibly damaging Het
Lama5 A G 2: 180,189,445 V1807A possibly damaging Het
Lats1 T G 10: 7,705,605 V718G probably damaging Het
Mef2b A G 8: 70,164,260 K4E probably damaging Het
Mertk T C 2: 128,782,617 probably null Het
Mroh8 A G 2: 157,228,700 V577A possibly damaging Het
Mtcl1 T G 17: 66,438,279 N381T probably damaging Het
Nfyc T A 4: 120,790,491 probably null Het
Nol4 C A 18: 23,039,876 W56L probably damaging Het
Notch2 A T 3: 98,142,956 D1849V probably damaging Het
Olfr1406 T C 1: 173,183,814 T207A probably benign Het
Olfr1436 A G 19: 12,298,712 M140T probably damaging Het
Olfr284 A G 15: 98,340,272 V239A possibly damaging Het
Olfr287 G A 15: 98,207,571 T271I probably damaging Het
Olfr297 A T 7: 86,527,098 T114S possibly damaging Het
Olfr733 T C 14: 50,298,898 N137S probably benign Het
Olfr846 T A 9: 19,361,175 Y60F probably damaging Het
Oxr1 G A 15: 41,801,582 V138I probably benign Het
Pars2 A G 4: 106,654,293 E424G possibly damaging Het
Peli2 C A 14: 48,168,269 Y50* probably null Het
Plag1 T A 4: 3,905,492 H66L probably benign Het
Psme4 T C 11: 30,821,079 probably benign Het
Robo1 A T 16: 73,004,535 S1016C probably damaging Het
Sgip1 C A 4: 102,921,083 D292E unknown Het
Skint4 T A 4: 112,087,035 C23S probably benign Het
Slc22a28 A C 19: 8,071,914 S323R probably damaging Het
Slc41a3 A G 6: 90,640,909 T306A probably benign Het
Spata13 A G 14: 60,749,996 M868V probably damaging Het
Spata6 T G 4: 111,746,181 I31S possibly damaging Het
Sycp3 A T 10: 88,466,504 K119* probably null Het
Tlk2 T A 11: 105,281,220 S739T unknown Het
Trim10 T C 17: 36,877,128 V412A probably damaging Het
Ttc3 T A 16: 94,410,906 F377I probably benign Het
Uck1 T A 2: 32,256,034 H283L probably damaging Het
Unc5a T C 13: 54,995,868 Y122H possibly damaging Het
Uncx C T 5: 139,544,622 R152* probably null Het
Usp44 A G 10: 93,845,655 probably benign Het
Vamp2 A C 11: 69,089,738 D44A probably benign Het
Vmn2r83 A G 10: 79,469,015 T20A probably benign Het
Vmn2r84 A T 10: 130,385,915 I812N probably damaging Het
Vrtn T G 12: 84,649,169 L231R probably damaging Het
Wdr75 A G 1: 45,820,173 T677A probably damaging Het
Xylt1 C A 7: 117,548,865 S221R possibly damaging Het
Zscan22 A G 7: 12,904,056 E125G possibly damaging Het
Zxdc A T 6: 90,373,716 H383L probably damaging Het
Other mutations in Rrbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Rrbp1 APN 2 143968618 missense possibly damaging 0.93
IGL01636:Rrbp1 APN 2 143947895 unclassified probably benign
IGL01923:Rrbp1 APN 2 143990161 missense probably damaging 1.00
IGL02513:Rrbp1 APN 2 143988430 missense possibly damaging 0.55
IGL02548:Rrbp1 APN 2 143949759 splice site probably benign
IGL02678:Rrbp1 APN 2 143990187 missense probably damaging 0.98
FR4449:Rrbp1 UTSW 2 143967456 frame shift probably null
R0127:Rrbp1 UTSW 2 143989944 missense probably benign 0.21
R0611:Rrbp1 UTSW 2 143988516 missense probably damaging 1.00
R0881:Rrbp1 UTSW 2 143953253 missense probably benign 0.09
R1439:Rrbp1 UTSW 2 143955112 critical splice donor site probably null
R1534:Rrbp1 UTSW 2 143988313 missense probably damaging 1.00
R1604:Rrbp1 UTSW 2 143989390 missense probably damaging 0.99
R1920:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R1921:Rrbp1 UTSW 2 143988291 missense probably benign 0.16
R2152:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2153:Rrbp1 UTSW 2 143954198 missense possibly damaging 0.75
R2319:Rrbp1 UTSW 2 143957559 missense probably benign 0.01
R2850:Rrbp1 UTSW 2 143949349 missense probably benign 0.09
R2864:Rrbp1 UTSW 2 143957637 missense probably damaging 0.99
R3433:Rrbp1 UTSW 2 143952280 splice site probably benign
R3707:Rrbp1 UTSW 2 143953277 missense probably benign 0.01
R3837:Rrbp1 UTSW 2 143989558 missense probably damaging 1.00
R4073:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4074:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4076:Rrbp1 UTSW 2 143963110 missense probably benign 0.16
R4279:Rrbp1 UTSW 2 143963108 missense probably benign 0.16
R4583:Rrbp1 UTSW 2 143988751 missense probably benign 0.03
R4820:Rrbp1 UTSW 2 143964765 missense possibly damaging 0.78
R4829:Rrbp1 UTSW 2 143989687 missense probably benign 0.18
R4836:Rrbp1 UTSW 2 143988417 missense possibly damaging 0.75
R5589:Rrbp1 UTSW 2 143989966 missense probably benign 0.16
R5801:Rrbp1 UTSW 2 143989783 missense probably damaging 1.00
R5806:Rrbp1 UTSW 2 143963331 missense probably benign 0.16
R5955:Rrbp1 UTSW 2 143949677 missense probably benign 0.06
R6102:Rrbp1 UTSW 2 143988393 missense probably damaging 1.00
R6368:Rrbp1 UTSW 2 143989555 missense probably damaging 1.00
R6916:Rrbp1 UTSW 2 143974598 missense probably benign 0.03
R7022:Rrbp1 UTSW 2 143957802 intron probably null
R7061:Rrbp1 UTSW 2 143989167 missense possibly damaging 0.61
R7136:Rrbp1 UTSW 2 143949680 missense probably benign 0.16
R7291:Rrbp1 UTSW 2 143969462 missense probably benign 0.09
Z1088:Rrbp1 UTSW 2 143974486 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTGGAAACATTCTCGTTGC -3'
(R):5'- AGGAAGTTCACTGTACCAGC -3'

Sequencing Primer
(F):5'- GAAACATTCTCGTTGCAGTCGGAC -3'
(R):5'- GGAAGTTCACTGTACCAGCCTAAAG -3'
Posted On2019-06-07