Incidental Mutation 'PIT4434001:Pogz'
ID555048
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Namepogo transposable element with ZNF domain
Synonyms9530006B08Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94837567-94882326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94872370 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 538 (T538A)
Ref Sequence ENSEMBL: ENSMUSP00000102891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
Predicted Effect probably damaging
Transcript: ENSMUST00000042402
AA Change: T529A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: T529A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107266
AA Change: T485A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: T485A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107269
AA Change: T443A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: T443A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107270
AA Change: T538A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: T538A

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140397
SMART Domains Protein: ENSMUSP00000122492
Gene: ENSMUSG00000038902

DomainStartEndE-ValueType
low complexity region 31 38 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Eri2 A G 7: 119,786,301 F326L probably benign Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Fbxw20 A G 9: 109,223,432 S278P probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Kdm4c A G 4: 74,271,332 T95A probably benign Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Taar7a A G 10: 23,993,421 F21L probably benign Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Vps13d A T 4: 145,155,247 F1259I Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
FR4976:Pogz UTSW 3 94874695 unclassified probably benign
PIT4382001:Pogz UTSW 3 94879796 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1670:Pogz UTSW 3 94878849 missense probably benign 0.21
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1855:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R6104:Pogz UTSW 3 94880031 missense probably benign 0.09
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTAGTTGGGGAGCAAATCG -3'
(R):5'- TAGCTCACCACCTACTATTTCACGG -3'

Sequencing Primer
(F):5'- CTTTGTGCTGTGCTACAG -3'
(R):5'- TTCACGGACAACACCAATTTAATAG -3'
Posted On2019-06-07