Incidental Mutation 'PIT4434001:Kdm4c'
ID555051
Institutional Source Beutler Lab
Gene Symbol Kdm4c
Ensembl Gene ENSMUSG00000028397
Gene Namelysine (K)-specific demethylase 4C
SynonymsJmjd2c, 2410141F18Rik
Accession Numbers

Genbank: NM_001172095; MGI: 1924054

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location74242497-74405860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74271332 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 95 (T95A)
Ref Sequence ENSEMBL: ENSMUSP00000030102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030102] [ENSMUST00000077851] [ENSMUST00000149295]
Predicted Effect probably benign
Transcript: ENSMUST00000030102
AA Change: T95A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000030102
Gene: ENSMUSG00000028397
AA Change: T95A

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077851
AA Change: T95A

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000077017
Gene: ENSMUSG00000028397
AA Change: T95A

DomainStartEndE-ValueType
JmjN 15 57 9.12e-14 SMART
JmjC 144 310 1.31e-61 SMART
low complexity region 361 374 N/A INTRINSIC
low complexity region 386 400 N/A INTRINSIC
PHD 687 745 3.3e-5 SMART
PHD 807 863 8.71e-5 SMART
TUDOR 875 932 2.96e-10 SMART
TUDOR 933 989 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149295
SMART Domains Protein: ENSMUSP00000118728
Gene: ENSMUSG00000028397

DomainStartEndE-ValueType
Pfam:JmjN 17 49 9.4e-14 PFAM
low complexity region 102 115 N/A INTRINSIC
low complexity region 127 141 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Jumonji domain 2 (JMJD2) family. The encoded protein is a trimethylation-specific demethylase, and converts specific trimethylated histone residues to the dimethylated form. This enzymatic action regulates gene expression and chromosome segregation. Chromosomal aberrations and changes in expression of this gene may be found in tumor cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a null gene trap allele cannot be produced likely due to embryonic lethality. Mice heterozygous for a null gene trap allele exhibit reduced body weight and lower incidence and multiplicity of both benign and malignant tumors in mice treated with DMBA and TPA. [provided by MGI curators]
Allele List at MGI

All alleles(402) : Targeted, other(2) Gene trapped(400)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Eri2 A G 7: 119,786,301 F326L probably benign Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Fbxw20 A G 9: 109,223,432 S278P probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Pogz A G 3: 94,872,370 T538A probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Taar7a A G 10: 23,993,421 F21L probably benign Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Vps13d A T 4: 145,155,247 F1259I Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Kdm4c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Kdm4c APN 4 74345501 missense probably benign 0.19
IGL00225:Kdm4c APN 4 74345567 missense probably benign 0.03
IGL00672:Kdm4c APN 4 74343514 missense probably benign 0.00
IGL00897:Kdm4c APN 4 74373684 missense probably damaging 1.00
IGL01479:Kdm4c APN 4 74343501 missense probably benign 0.18
IGL01707:Kdm4c APN 4 74336927 missense probably damaging 1.00
IGL02142:Kdm4c APN 4 74307016 critical splice donor site probably null
IGL02268:Kdm4c APN 4 74373716 missense possibly damaging 0.94
IGL02662:Kdm4c APN 4 74404821 missense probably damaging 0.99
IGL03377:Kdm4c APN 4 74271255 missense possibly damaging 0.82
3-1:Kdm4c UTSW 4 74334673 missense probably benign 0.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0096:Kdm4c UTSW 4 74357343 missense probably damaging 1.00
R0219:Kdm4c UTSW 4 74373620 missense probably damaging 1.00
R0309:Kdm4c UTSW 4 74345567 missense probably benign 0.00
R0512:Kdm4c UTSW 4 74333794 missense probably benign
R1070:Kdm4c UTSW 4 74373628 nonsense probably null
R1518:Kdm4c UTSW 4 74333826 missense probably benign
R1713:Kdm4c UTSW 4 74298484 missense probably benign 0.10
R1769:Kdm4c UTSW 4 74280997 missense possibly damaging 0.66
R1927:Kdm4c UTSW 4 74345483 missense probably benign 0.00
R1962:Kdm4c UTSW 4 74307016 intron probably benign
R1992:Kdm4c UTSW 4 74343394 missense possibly damaging 0.71
R2389:Kdm4c UTSW 4 74333870 critical splice donor site probably null
R2979:Kdm4c UTSW 4 74373728 nonsense probably null
R3966:Kdm4c UTSW 4 74298583 missense probably damaging 1.00
R4094:Kdm4c UTSW 4 74311678 missense probably benign
R4171:Kdm4c UTSW 4 74280898 missense possibly damaging 0.73
R4543:Kdm4c UTSW 4 74330760 missense probably benign 0.01
R4581:Kdm4c UTSW 4 74357339 splice site probably null
R5019:Kdm4c UTSW 4 74343535 missense probably damaging 1.00
R5088:Kdm4c UTSW 4 74334699 missense probably benign
R5533:Kdm4c UTSW 4 74315649 intron probably benign
R5663:Kdm4c UTSW 4 74399348 missense probably damaging 1.00
R5691:Kdm4c UTSW 4 74334728 missense probably benign
R5775:Kdm4c UTSW 4 74359431 missense probably damaging 1.00
R5786:Kdm4c UTSW 4 74359485 missense probably damaging 0.98
R6002:Kdm4c UTSW 4 74404969 missense possibly damaging 0.95
R6375:Kdm4c UTSW 4 74330715 missense probably damaging 0.96
R6491:Kdm4c UTSW 4 74373636 missense probably damaging 1.00
R6790:Kdm4c UTSW 4 74391461 missense probably damaging 1.00
R6952:Kdm4c UTSW 4 74357350 missense probably damaging 1.00
R7157:Kdm4c UTSW 4 74345567 missense probably benign 0.01
R7319:Kdm4c UTSW 4 74336963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACTGCAAAGTATTAGTGAGTG -3'
(R):5'- TGAGTAAGCCGTCATTTGAAGAACAG -3'

Sequencing Primer
(F):5'- ACAGAGGTATTGAGAAAATGTGTTC -3'
(R):5'- CCGTCATTTGAAGAACAGAAACCAGG -3'
Posted On2019-06-07