Incidental Mutation 'PIT4434001:Vps13d'
ID555052
Institutional Source Beutler Lab
Gene Symbol Vps13d
Ensembl Gene ENSMUSG00000020220
Gene Namevacuolar protein sorting 13D
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location144972622-145195005 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 145155247 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 1259 (F1259I)
Ref Sequence ENSEMBL: ENSMUSP00000043240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020441] [ENSMUST00000036579]
Predicted Effect probably benign
Transcript: ENSMUST00000020441
AA Change: F1253I

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000020441
Gene: ENSMUSG00000020220
AA Change: F1253I

DomainStartEndE-ValueType
Pfam:Chorein_N 2 118 1.8e-37 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
coiled coil region 665 685 N/A INTRINSIC
low complexity region 765 781 N/A INTRINSIC
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2866 2884 N/A INTRINSIC
low complexity region 2973 2983 N/A INTRINSIC
Pfam:DUF1162 3246 3530 1.1e-110 PFAM
low complexity region 3797 3810 N/A INTRINSIC
low complexity region 3913 3921 N/A INTRINSIC
low complexity region 4119 4132 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000043240
Gene: ENSMUSG00000020220
AA Change: F1259I

DomainStartEndE-ValueType
Pfam:Chorein_N 2 116 3.5e-35 PFAM
Pfam:VPS13 131 353 9.6e-57 PFAM
low complexity region 407 423 N/A INTRINSIC
low complexity region 534 555 N/A INTRINSIC
Pfam:VPS13_mid_rpt 608 896 4.3e-35 PFAM
low complexity region 1316 1329 N/A INTRINSIC
low complexity region 1590 1603 N/A INTRINSIC
Blast:IL1 1605 1726 2e-6 BLAST
low complexity region 1868 1883 N/A INTRINSIC
low complexity region 2128 2141 N/A INTRINSIC
UBA 2632 2669 3.73e-5 SMART
low complexity region 2674 2684 N/A INTRINSIC
low complexity region 2707 2718 N/A INTRINSIC
low complexity region 2891 2909 N/A INTRINSIC
low complexity region 2998 3008 N/A INTRINSIC
Pfam:SHR-BD 3271 3555 4.2e-86 PFAM
low complexity region 3822 3835 N/A INTRINSIC
low complexity region 3938 3946 N/A INTRINSIC
Pfam:VPS13_C 3978 4126 4.8e-24 PFAM
low complexity region 4144 4157 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the vacuolar-protein-sorting-13 gene family. In yeast, vacuolar-protein-sorting-13 proteins are involved in trafficking of membrane proteins between the trans-Golgi network and the prevacuolar compartment. While several transcript variants may exist for this gene, the full-length natures of only two have been described to date. These two represent the major variants of this gene and encode distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Eri2 A G 7: 119,786,301 F326L probably benign Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Fbxw20 A G 9: 109,223,432 S278P probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Kdm4c A G 4: 74,271,332 T95A probably benign Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Pogz A G 3: 94,872,370 T538A probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Taar7a A G 10: 23,993,421 F21L probably benign Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Vps13d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Vps13d APN 4 145168540 missense probably damaging 0.98
IGL00484:Vps13d APN 4 145126575 missense probably benign 0.04
IGL00591:Vps13d APN 4 145190559 missense possibly damaging 0.95
IGL00816:Vps13d APN 4 145155994 missense probably benign 0.00
IGL00835:Vps13d APN 4 145160652 missense probably damaging 0.97
IGL00847:Vps13d APN 4 145085408 missense probably benign 0.26
IGL01084:Vps13d APN 4 145154955 missense probably benign 0.00
IGL01116:Vps13d APN 4 144972750 unclassified probably benign
IGL01150:Vps13d APN 4 145149275 missense probably benign
IGL01329:Vps13d APN 4 145156206 missense possibly damaging 0.69
IGL01338:Vps13d APN 4 145088322 missense probably damaging 1.00
IGL01583:Vps13d APN 4 145045088 missense probably damaging 1.00
IGL01598:Vps13d APN 4 145016901 missense probably benign 0.21
IGL01620:Vps13d APN 4 145094867 missense possibly damaging 0.70
IGL01636:Vps13d APN 4 145075048 missense probably damaging 1.00
IGL01723:Vps13d APN 4 145173145 missense possibly damaging 0.84
IGL01895:Vps13d APN 4 145156266 missense possibly damaging 0.57
IGL01981:Vps13d APN 4 145086747 missense probably damaging 0.99
IGL02192:Vps13d APN 4 145148858 missense probably benign 0.02
IGL02197:Vps13d APN 4 145128309 missense probably benign 0.01
IGL02209:Vps13d APN 4 145156101 missense probably damaging 0.97
IGL02219:Vps13d APN 4 145168146 missense probably benign 0.00
IGL02377:Vps13d APN 4 145156364 missense probably damaging 1.00
IGL02404:Vps13d APN 4 145148735 missense probably damaging 1.00
IGL02552:Vps13d APN 4 145173137 missense possibly damaging 0.46
IGL02651:Vps13d APN 4 145164559 missense probably benign 0.02
IGL02708:Vps13d APN 4 145128280 missense probably benign 0.12
IGL02811:Vps13d APN 4 145131765 missense possibly damaging 0.55
IGL02821:Vps13d APN 4 145148762 missense probably damaging 0.98
IGL02838:Vps13d APN 4 145075025 missense probably benign 0.31
IGL02968:Vps13d APN 4 145122498 missense probably benign 0.32
IGL03176:Vps13d APN 4 145074963 missense probably benign 0.16
IGL03352:Vps13d APN 4 145167502 missense possibly damaging 0.49
IGL03374:Vps13d APN 4 145108575 missense possibly damaging 0.70
IGL03375:Vps13d APN 4 145091947 missense probably damaging 1.00
IGL03383:Vps13d APN 4 145168319 critical splice acceptor site probably null
IGL03411:Vps13d APN 4 145149324 missense probably damaging 1.00
PIT4283001:Vps13d UTSW 4 145108588 missense
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0069:Vps13d UTSW 4 145062563 missense probably benign 0.09
R0076:Vps13d UTSW 4 145164694 splice site probably benign
R0211:Vps13d UTSW 4 145114778 missense probably benign 0.08
R0219:Vps13d UTSW 4 145105909 missense probably benign 0.01
R0284:Vps13d UTSW 4 145144802 missense probably benign 0.01
R0345:Vps13d UTSW 4 145117625 missense possibly damaging 0.81
R0400:Vps13d UTSW 4 145065827 missense probably benign 0.00
R0417:Vps13d UTSW 4 144976560 missense probably benign 0.19
R0538:Vps13d UTSW 4 145045095 missense probably damaging 1.00
R0560:Vps13d UTSW 4 145054190 missense probably damaging 1.00
R0627:Vps13d UTSW 4 145087184 missense probably damaging 1.00
R0707:Vps13d UTSW 4 145155932 missense probably damaging 1.00
R0782:Vps13d UTSW 4 145126625 splice site probably benign
R0925:Vps13d UTSW 4 145156551 missense probably damaging 1.00
R0993:Vps13d UTSW 4 145117692 nonsense probably null
R1135:Vps13d UTSW 4 145155589 missense probably benign 0.01
R1165:Vps13d UTSW 4 145126471 missense probably benign
R1263:Vps13d UTSW 4 145170348 missense probably benign 0.01
R1397:Vps13d UTSW 4 145141334 missense probably damaging 1.00
R1398:Vps13d UTSW 4 145099983 missense probably null
R1521:Vps13d UTSW 4 145105861 missense probably benign 0.00
R1522:Vps13d UTSW 4 145098172 splice site probably null
R1725:Vps13d UTSW 4 145143260 missense possibly damaging 0.90
R1759:Vps13d UTSW 4 145155857 missense probably benign
R1826:Vps13d UTSW 4 145155003 missense probably damaging 0.96
R1900:Vps13d UTSW 4 145126606 missense probably benign 0.23
R1943:Vps13d UTSW 4 145155857 missense probably benign
R1955:Vps13d UTSW 4 145156143 missense probably damaging 1.00
R2008:Vps13d UTSW 4 145155243 missense probably benign 0.00
R2013:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2014:Vps13d UTSW 4 145108508 missense probably damaging 0.99
R2038:Vps13d UTSW 4 145181115 critical splice donor site probably null
R2108:Vps13d UTSW 4 145075047 missense probably damaging 0.99
R2130:Vps13d UTSW 4 145156101 missense probably benign 0.17
R2134:Vps13d UTSW 4 145148339 missense probably benign 0.00
R2168:Vps13d UTSW 4 145087323 splice site probably benign
R2220:Vps13d UTSW 4 145178320 missense probably damaging 1.00
R2240:Vps13d UTSW 4 145110895 missense possibly damaging 0.70
R2332:Vps13d UTSW 4 145148686 missense probably benign
R2357:Vps13d UTSW 4 145074977 frame shift probably null
R2365:Vps13d UTSW 4 145087324 splice site probably benign
R2571:Vps13d UTSW 4 145149136 missense probably benign 0.20
R3149:Vps13d UTSW 4 145126577 missense possibly damaging 0.70
R3150:Vps13d UTSW 4 145086790 missense probably damaging 0.98
R3547:Vps13d UTSW 4 145074975 missense probably damaging 0.99
R3716:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3718:Vps13d UTSW 4 145075726 missense probably damaging 1.00
R3725:Vps13d UTSW 4 145115648 splice site probably benign
R3794:Vps13d UTSW 4 145085437 splice site probably benign
R3875:Vps13d UTSW 4 145190544 missense probably damaging 1.00
R3948:Vps13d UTSW 4 145141340 missense probably damaging 1.00
R3953:Vps13d UTSW 4 145148880 missense probably damaging 1.00
R4021:Vps13d UTSW 4 145075061 missense possibly damaging 0.90
R4323:Vps13d UTSW 4 145152778 missense probably benign 0.28
R4346:Vps13d UTSW 4 145072529 intron probably benign
R4509:Vps13d UTSW 4 145062602 missense probably damaging 1.00
R4613:Vps13d UTSW 4 145131655 missense possibly damaging 0.95
R4657:Vps13d UTSW 4 145074842 missense probably damaging 1.00
R4680:Vps13d UTSW 4 145108510 missense possibly damaging 0.94
R4688:Vps13d UTSW 4 145178212 missense probably benign
R4797:Vps13d UTSW 4 145054155 missense probably damaging 1.00
R4798:Vps13d UTSW 4 145178056 missense probably damaging 0.98
R4817:Vps13d UTSW 4 145069165 missense probably damaging 1.00
R4839:Vps13d UTSW 4 145085430 missense possibly damaging 0.95
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4860:Vps13d UTSW 4 145087161 missense probably benign
R4869:Vps13d UTSW 4 145128042 missense probably damaging 1.00
R4904:Vps13d UTSW 4 145155445 missense probably damaging 1.00
R4912:Vps13d UTSW 4 145155857 missense probably benign
R4916:Vps13d UTSW 4 144983393 missense probably damaging 1.00
R4976:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5029:Vps13d UTSW 4 145156282 missense probably benign 0.02
R5049:Vps13d UTSW 4 145086766 missense probably damaging 1.00
R5077:Vps13d UTSW 4 145088241 missense probably damaging 0.98
R5119:Vps13d UTSW 4 145105898 missense possibly damaging 0.82
R5227:Vps13d UTSW 4 145181207 splice site probably null
R5291:Vps13d UTSW 4 145062569 missense probably damaging 0.99
R5344:Vps13d UTSW 4 145178334 missense probably damaging 0.98
R5348:Vps13d UTSW 4 145065889 missense probably damaging 0.99
R5478:Vps13d UTSW 4 145167550 missense probably damaging 0.99
R5632:Vps13d UTSW 4 145074882 missense probably damaging 0.99
R5642:Vps13d UTSW 4 145170302 missense possibly damaging 0.66
R5712:Vps13d UTSW 4 145087173 missense probably benign 0.07
R5747:Vps13d UTSW 4 145168283 missense probably benign 0.00
R5752:Vps13d UTSW 4 145148970 missense probably benign 0.06
R5804:Vps13d UTSW 4 145100070 missense probably benign 0.03
R5917:Vps13d UTSW 4 145100010 missense probably damaging 0.96
R5932:Vps13d UTSW 4 145045041 missense possibly damaging 0.71
R5940:Vps13d UTSW 4 145074975 missense probably benign 0.09
R5978:Vps13d UTSW 4 145122611 missense probably benign
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6031:Vps13d UTSW 4 145168509 missense probably benign 0.01
R6143:Vps13d UTSW 4 145148565 missense possibly damaging 0.95
R6174:Vps13d UTSW 4 144975193 nonsense probably null
R6191:Vps13d UTSW 4 145149348 missense probably damaging 1.00
R6198:Vps13d UTSW 4 145148990 missense probably benign 0.28
R6374:Vps13d UTSW 4 145122681 missense probably damaging 1.00
R6379:Vps13d UTSW 4 145088258 missense probably benign
R6388:Vps13d UTSW 4 145155574 missense probably benign 0.06
R6418:Vps13d UTSW 4 145092280 missense probably damaging 0.98
R6466:Vps13d UTSW 4 145057495 missense possibly damaging 0.47
R6602:Vps13d UTSW 4 145103664 intron probably benign
R6604:Vps13d UTSW 4 145181124 missense probably damaging 1.00
R7051:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7052:Vps13d UTSW 4 145163344 missense probably benign 0.00
R7103:Vps13d UTSW 4 145115492 missense
R7231:Vps13d UTSW 4 145057462 missense
R7246:Vps13d UTSW 4 145156050 missense
R7339:Vps13d UTSW 4 145121368 missense
R7409:Vps13d UTSW 4 145141254 missense
R7419:Vps13d UTSW 4 145115503 missense
R7424:Vps13d UTSW 4 145148747 missense
R7439:Vps13d UTSW 4 145105856 missense
R7440:Vps13d UTSW 4 145128411 missense
X0021:Vps13d UTSW 4 145155025 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACTGTACTCGGCAGTCTTG -3'
(R):5'- ACCAAGGTGAACGTGTCGATG -3'

Sequencing Primer
(F):5'- TGGCTAACACTGTGGTCAC -3'
(R):5'- GGGCAGCTCGTTTGACATGAAC -3'
Posted On2019-06-07