Incidental Mutation 'PIT4434001:Eri2'
ID555062
Institutional Source Beutler Lab
Gene Symbol Eri2
Ensembl Gene ENSMUSG00000030929
Gene Nameexoribonuclease 2
Synonyms4933424N09Rik, Exod1
Accession Numbers

Genbank: NM_027698

Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #PIT4434001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location119768679-119794058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119786301 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 326 (F326L)
Ref Sequence ENSEMBL: ENSMUSP00000120547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033224] [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529] [ENSMUST00000139192] [ENSMUST00000150844]
Predicted Effect probably benign
Transcript: ENSMUST00000033224
Predicted Effect probably benign
Transcript: ENSMUST00000063770
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106526
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106527
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106528
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106529
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139192
SMART Domains Protein: ENSMUSP00000117940
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
Pfam:RNase_T 21 160 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150844
AA Change: F326L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120547
Gene: ENSMUSG00000030929
AA Change: F326L

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
low complexity region 362 381 N/A INTRINSIC
Pfam:zf-GRF 592 640 1.4e-21 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.6%
  • 10x: 84.3%
  • 20x: 70.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik T A 11: 117,806,043 D196E probably benign Het
Abcb5 G A 12: 118,890,687 S831F probably damaging Het
Alg2 C A 4: 47,474,076 A71S probably benign Het
Ankrd50 T C 3: 38,455,263 Q62R possibly damaging Het
Ano1 A G 7: 144,610,895 V664A probably benign Het
Bbox1 A C 2: 110,275,634 D188E probably benign Het
Bmi1 C T 2: 18,684,231 T242M probably benign Het
C4bp A G 1: 130,657,210 F30L probably benign Het
Carmil3 A G 14: 55,494,688 N214S probably null Het
Cep162 C A 9: 87,193,648 K1310N probably damaging Het
Cfap74 G A 4: 155,463,964 V21M unknown Het
Copa A G 1: 172,106,175 D401G probably benign Het
Cyp4f14 A G 17: 32,906,130 V439A possibly damaging Het
Ddhd1 A C 14: 45,610,605 N569K possibly damaging Het
Dennd5a A G 7: 109,933,624 L313P probably damaging Het
Fam135a A T 1: 24,029,195 H864Q probably benign Het
Fat3 C T 9: 15,996,316 V2797I probably benign Het
Fbn2 T C 18: 58,096,062 D692G probably damaging Het
Fbxw20 A G 9: 109,223,432 S278P probably damaging Het
Gna12 A T 5: 140,761,018 V224E probably damaging Het
Grn C T 11: 102,435,940 H482Y possibly damaging Het
Igkv7-33 A G 6: 70,058,813 Y62H possibly damaging Het
Kdm4c A G 4: 74,271,332 T95A probably benign Het
Lrp3 T C 7: 35,203,995 T309A probably damaging Het
Map3k2 C A 18: 32,210,035 D279E possibly damaging Het
Map3k5 T A 10: 20,026,257 V358E probably damaging Het
Mcpt9 A G 14: 56,029,229 S14P probably benign Het
Olfr1358 T C 10: 78,519,715 F36L possibly damaging Het
Olfr570 T C 7: 102,900,630 F88L probably benign Het
Olfr622 A C 7: 103,639,847 C98G probably damaging Het
Otud7b G A 3: 96,140,465 R45H probably damaging Het
Pcdhb17 A G 18: 37,485,651 N165D probably damaging Het
Pogz A G 3: 94,872,370 T538A probably damaging Het
Prlr A G 15: 10,328,372 E311G probably damaging Het
Ptprs T C 17: 56,454,984 I43V probably null Het
Raet1d A T 10: 22,371,534 K170* probably null Het
Rufy2 A T 10: 62,991,066 Q128L possibly damaging Het
Svopl T C 6: 38,014,866 N360D possibly damaging Het
Syt4 A C 18: 31,440,331 L377W probably damaging Het
Taar7a A G 10: 23,993,421 F21L probably benign Het
Tax1bp3 T A 11: 73,180,804 M78K probably damaging Het
Top2b T C 14: 16,423,780 probably null Het
Trim52 A T 14: 106,107,298 D130V probably benign Het
Ttc1 T C 11: 43,745,128 Y96C probably damaging Het
Vmn2r49 T C 7: 9,976,835 T657A probably damaging Het
Vps13d A T 4: 145,155,247 F1259I Het
Zbtb18 A T 1: 177,448,423 T441S possibly damaging Het
Other mutations in Eri2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Eri2 APN 7 119787741 missense probably benign 0.44
IGL00987:Eri2 APN 7 119791166 missense probably damaging 1.00
IGL01139:Eri2 APN 7 119786737 critical splice donor site probably null
IGL01476:Eri2 APN 7 119790249 missense probably damaging 1.00
IGL02019:Eri2 APN 7 119786080 nonsense probably null
IGL02208:Eri2 APN 7 119785935 missense probably benign 0.00
IGL02395:Eri2 APN 7 119787810 missense probably damaging 0.98
IGL02405:Eri2 APN 7 119785482 missense probably damaging 1.00
IGL02646:Eri2 APN 7 119786108 missense possibly damaging 0.87
IGL02659:Eri2 APN 7 119787442 missense probably damaging 0.98
alien UTSW 7 119791174 missense probably damaging 1.00
extraterrestrial UTSW 7 119793916 critical splice donor site probably null
G5030:Eri2 UTSW 7 119786378 missense possibly damaging 0.58
K7894:Eri2 UTSW 7 119785271 missense probably benign 0.39
R0152:Eri2 UTSW 7 119790383 missense probably damaging 1.00
R0378:Eri2 UTSW 7 119793916 critical splice donor site probably null
R0532:Eri2 UTSW 7 119785983 missense probably benign 0.22
R0630:Eri2 UTSW 7 119786417 missense probably benign 0.27
R1192:Eri2 UTSW 7 119792317 missense probably damaging 1.00
R1416:Eri2 UTSW 7 119791174 missense probably damaging 1.00
R1884:Eri2 UTSW 7 119791123 missense probably benign 0.12
R2173:Eri2 UTSW 7 119786543 missense possibly damaging 0.67
R2961:Eri2 UTSW 7 119785344 missense probably benign
R3805:Eri2 UTSW 7 119786008 nonsense probably null
R3807:Eri2 UTSW 7 119786008 nonsense probably null
R4534:Eri2 UTSW 7 119790243 missense probably damaging 1.00
R4738:Eri2 UTSW 7 119787732 critical splice donor site probably null
R4776:Eri2 UTSW 7 119784946 utr 3 prime probably benign
R4780:Eri2 UTSW 7 119785680 missense probably benign 0.43
R5037:Eri2 UTSW 7 119785674 missense probably benign
R5260:Eri2 UTSW 7 119787846 splice site probably benign
R5315:Eri2 UTSW 7 119786018 missense probably benign 0.00
R5884:Eri2 UTSW 7 119772329 makesense probably null
R5927:Eri2 UTSW 7 119786068 missense probably damaging 1.00
R6937:Eri2 UTSW 7 119786789 missense probably damaging 0.96
R7296:Eri2 UTSW 7 119786516 nonsense probably null
R7302:Eri2 UTSW 7 119786786 missense probably benign 0.38
R7480:Eri2 UTSW 7 119786511 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCAACATCGGTAAACAGTC -3'
(R):5'- AACATGAGTATCCAGGGCCC -3'

Sequencing Primer
(F):5'- CATGATTAACTGACGGAATGGTTG -3'
(R):5'- GTATCCAGGGCCCCAGCATATATC -3'
Posted On2019-06-07