Incidental Mutation 'PIT4520001:Fam160a1'
ID555163
Institutional Source Beutler Lab
Gene Symbol Fam160a1
Ensembl Gene ENSMUSG00000051000
Gene Namefamily with sequence similarity 160, member A1
Synonyms9930021J17Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4520001 (G1)
Quality Score189.009
Status Not validated
Chromosome3
Chromosomal Location85660061-85817291 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 85672472 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 809 (Q809*)
Ref Sequence ENSEMBL: ENSMUSP00000091700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094148] [ENSMUST00000118408] [ENSMUST00000119077] [ENSMUST00000154148]
Predicted Effect probably null
Transcript: ENSMUST00000094148
AA Change: Q809*
SMART Domains Protein: ENSMUSP00000091700
Gene: ENSMUSG00000051000
AA Change: Q809*

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.2e-102 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118408
AA Change: Q809*
SMART Domains Protein: ENSMUSP00000113235
Gene: ENSMUSG00000051000
AA Change: Q809*

DomainStartEndE-ValueType
Pfam:RAI16-like 88 411 1.1e-98 PFAM
low complexity region 483 500 N/A INTRINSIC
low complexity region 613 622 N/A INTRINSIC
low complexity region 838 853 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119077
SMART Domains Protein: ENSMUSP00000112705
Gene: ENSMUSG00000051000

DomainStartEndE-ValueType
low complexity region 67 84 N/A INTRINSIC
low complexity region 197 206 N/A INTRINSIC
low complexity region 422 437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154148
SMART Domains Protein: ENSMUSP00000116393
Gene: ENSMUSG00000102805

DomainStartEndE-ValueType
Arfaptin 1 227 7.15e-121 SMART
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Fam160a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Fam160a1 APN 3 85672618 missense probably benign 0.01
IGL01102:Fam160a1 APN 3 85665501 intron probably benign
IGL01317:Fam160a1 APN 3 85672846 missense probably benign 0.01
IGL01759:Fam160a1 APN 3 85688447 missense probably damaging 1.00
IGL02007:Fam160a1 APN 3 85722445 missense probably damaging 1.00
IGL02037:Fam160a1 APN 3 85730632 missense probably damaging 0.99
IGL02163:Fam160a1 APN 3 85688552 missense possibly damaging 0.92
IGL02192:Fam160a1 APN 3 85673326 missense possibly damaging 0.82
IGL02617:Fam160a1 APN 3 85673037 missense probably benign 0.00
PIT4378001:Fam160a1 UTSW 3 85730551 missense probably damaging 1.00
PIT4651001:Fam160a1 UTSW 3 85683641 missense probably damaging 1.00
R0590:Fam160a1 UTSW 3 85672376 missense probably benign 0.13
R0625:Fam160a1 UTSW 3 85730500 missense possibly damaging 0.84
R0648:Fam160a1 UTSW 3 85730614 missense probably damaging 1.00
R0931:Fam160a1 UTSW 3 85673243 missense probably benign
R0940:Fam160a1 UTSW 3 85665490 missense possibly damaging 0.92
R0941:Fam160a1 UTSW 3 85673059 missense probably benign 0.03
R1115:Fam160a1 UTSW 3 85722495 missense probably benign 0.02
R1161:Fam160a1 UTSW 3 85672468 missense probably damaging 0.96
R1460:Fam160a1 UTSW 3 85730876 missense probably damaging 1.00
R1503:Fam160a1 UTSW 3 85672477 missense possibly damaging 0.70
R1545:Fam160a1 UTSW 3 85665954 missense probably damaging 1.00
R1820:Fam160a1 UTSW 3 85665829 missense probably damaging 1.00
R1907:Fam160a1 UTSW 3 85672633 missense probably benign 0.00
R1911:Fam160a1 UTSW 3 85661218 missense probably benign 0.12
R1928:Fam160a1 UTSW 3 85688531 missense probably damaging 1.00
R2200:Fam160a1 UTSW 3 85730321 missense probably damaging 1.00
R2235:Fam160a1 UTSW 3 85661101 missense probably damaging 0.97
R2373:Fam160a1 UTSW 3 85676097 nonsense probably null
R3084:Fam160a1 UTSW 3 85665968 critical splice acceptor site probably null
R4125:Fam160a1 UTSW 3 85665383 missense possibly damaging 0.87
R4601:Fam160a1 UTSW 3 85741180 missense probably damaging 1.00
R4612:Fam160a1 UTSW 3 85730372 nonsense probably null
R4665:Fam160a1 UTSW 3 85730681 missense probably damaging 1.00
R4673:Fam160a1 UTSW 3 85730713 missense probably damaging 1.00
R4707:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4783:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4785:Fam160a1 UTSW 3 85688570 missense probably damaging 1.00
R4825:Fam160a1 UTSW 3 85673432 missense possibly damaging 0.93
R4884:Fam160a1 UTSW 3 85683611 missense probably damaging 1.00
R5653:Fam160a1 UTSW 3 85722501 missense probably damaging 1.00
R5663:Fam160a1 UTSW 3 85672433 missense probably benign
R5764:Fam160a1 UTSW 3 85665865 missense probably damaging 1.00
R6134:Fam160a1 UTSW 3 85673344 missense possibly damaging 0.93
R6284:Fam160a1 UTSW 3 85672688 missense probably benign 0.01
R6789:Fam160a1 UTSW 3 85672558 nonsense probably null
R6843:Fam160a1 UTSW 3 85673045 missense probably damaging 0.96
R7305:Fam160a1 UTSW 3 85730524 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCCAACACCAAATGGGGATG -3'
(R):5'- TAGTCCCGATCCTGAGACAG -3'

Sequencing Primer
(F):5'- GATGACCCGGCCTCCAC -3'
(R):5'- CGATCCTGAGACAGAGTCAC -3'
Posted On2019-06-07