Incidental Mutation 'PIT4520001:Hscb'
ID555169
Institutional Source Beutler Lab
Gene Symbol Hscb
Ensembl Gene ENSMUSG00000043510
Gene NameHscB iron-sulfur cluster co-chaperone
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location110829070-110839777 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110835985 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 139 (Y139N)
Ref Sequence ENSEMBL: ENSMUSP00000062811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056937] [ENSMUST00000066160] [ENSMUST00000145318] [ENSMUST00000198373] [ENSMUST00000199937] [ENSMUST00000200172]
Predicted Effect probably damaging
Transcript: ENSMUST00000056937
AA Change: Y139N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062811
Gene: ENSMUSG00000043510
AA Change: Y139N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
DnaJ 70 135 6.53e-3 SMART
Pfam:HSCB_C 156 228 9.4e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066160
SMART Domains Protein: ENSMUSP00000066679
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 5.14e-3 SMART
S_TKc 224 490 7.35e-104 SMART
Predicted Effect
Predicted Effect probably damaging
Transcript: ENSMUST00000145318
AA Change: Y88N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120926
Gene: ENSMUSG00000043510
AA Change: Y88N

DomainStartEndE-ValueType
DnaJ 19 84 6.53e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198373
Predicted Effect probably benign
Transcript: ENSMUST00000199937
SMART Domains Protein: ENSMUSP00000143558
Gene: ENSMUSG00000029521

DomainStartEndE-ValueType
low complexity region 2 37 N/A INTRINSIC
low complexity region 41 72 N/A INTRINSIC
FHA 116 179 2.6e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200172
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DnaJ-type co-chaperone and member of the heat shock cognate B (HscB) family of proteins. The encoded protein plays a role in the synthesis of iron-sulfur clusters, protein cofactors that are involved in the redox reactions of mitochondrial electron transport and other processes. Cells in which this gene is knocked down exhibit reduced activity of iron-sulfur cluster-dependent enzymes including succinate dehydrogenase and aconitase. The encoded protein may stimulate the ATPase activity of the mitochondrial stress-70 protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Hscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Hscb APN 5 110830954 missense probably benign 0.00
IGL02170:Hscb APN 5 110839626 missense probably damaging 1.00
potsticker UTSW 5 110834792 missense probably damaging 1.00
R0277:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R0323:Hscb UTSW 5 110834690 missense possibly damaging 0.91
R1873:Hscb UTSW 5 110830957 missense probably benign
R1940:Hscb UTSW 5 110836060 missense probably benign
R3821:Hscb UTSW 5 110836328 missense probably damaging 1.00
R5294:Hscb UTSW 5 110834792 missense probably damaging 1.00
R5883:Hscb UTSW 5 110839578 missense probably benign
R6337:Hscb UTSW 5 110839494 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTAATAACCTGGAGCCAGCCTG -3'
(R):5'- GAGCTGTCATTTCCTCCCAG -3'

Sequencing Primer
(F):5'- GGCTACAACCAGTGATGTTTTC -3'
(R):5'- GTCATTTCCTCCCAGCTTTTATCTG -3'
Posted On2019-06-07