Incidental Mutation 'PIT4520001:Hpx'
ID555180
Institutional Source Beutler Lab
Gene Symbol Hpx
Ensembl Gene ENSMUSG00000030895
Gene Namehemopexin
SynonymsHpxn, hx
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4520001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105591613-105600137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105592134 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 357 (T357A)
Ref Sequence ENSEMBL: ENSMUSP00000033185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033185] [ENSMUST00000210531]
Predicted Effect probably benign
Transcript: ENSMUST00000033185
AA Change: T357A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033185
Gene: ENSMUSG00000030895
AA Change: T357A

DomainStartEndE-ValueType
HX 56 93 1.29e0 SMART
HX 97 140 5.52e-8 SMART
Blast:HX 143 186 3e-7 BLAST
HX 187 230 3.48e-5 SMART
HX 261 304 1.07e-5 SMART
HX 306 351 5.49e-3 SMART
Blast:HX 358 403 2e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000210531
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a plasma glycoprotein that binds heme with high affinity. The encoded protein is an acute phase protein that transports heme from the plasma to the liver and may be involved in protecting cells from oxidative stress. [provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene display an essentially normal phenotype. However, they have increased susceptiblity to induced hemolytic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Coil T C 11: 88,981,611 M266T probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Hpx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Hpx APN 7 105591770 missense probably damaging 1.00
IGL01861:Hpx APN 7 105592186 nonsense probably null
IGL02441:Hpx APN 7 105592223 missense probably damaging 1.00
IGL03117:Hpx APN 7 105600071 missense possibly damaging 0.94
IGL03230:Hpx APN 7 105599312 missense probably benign 0.04
IGL03376:Hpx APN 7 105592251 unclassified probably benign
IGL03392:Hpx APN 7 105592402 missense probably damaging 1.00
R0138:Hpx UTSW 7 105592238 missense probably damaging 1.00
R0364:Hpx UTSW 7 105596264 missense probably benign 0.18
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1195:Hpx UTSW 7 105599649 splice site probably benign
R1958:Hpx UTSW 7 105596396 missense probably damaging 1.00
R2007:Hpx UTSW 7 105595574 missense probably damaging 1.00
R2025:Hpx UTSW 7 105595104 missense probably damaging 1.00
R2173:Hpx UTSW 7 105592083 missense probably benign 0.01
R2207:Hpx UTSW 7 105592426 missense probably damaging 1.00
R3162:Hpx UTSW 7 105599640 intron probably benign
R3849:Hpx UTSW 7 105596291 missense probably damaging 1.00
R4206:Hpx UTSW 7 105595147 missense probably null 0.01
R4510:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4511:Hpx UTSW 7 105592088 missense possibly damaging 0.94
R4709:Hpx UTSW 7 105600036 missense probably benign 0.05
R5029:Hpx UTSW 7 105591764 missense probably damaging 1.00
R5540:Hpx UTSW 7 105591912 missense possibly damaging 0.67
R5631:Hpx UTSW 7 105595601 missense probably damaging 0.96
R5664:Hpx UTSW 7 105595148 missense probably benign 0.02
R5820:Hpx UTSW 7 105591788 missense possibly damaging 0.89
R5922:Hpx UTSW 7 105595624 missense probably damaging 1.00
R6707:Hpx UTSW 7 105595475 missense probably benign 0.09
R6714:Hpx UTSW 7 105595095 missense probably damaging 0.98
X0066:Hpx UTSW 7 105596387 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CGTCCTGGGAAGAAGACAAC -3'
(R):5'- TGCCTTTTCCTGGGATGATAAAG -3'

Sequencing Primer
(F):5'- GCAGACCTTGAATTAGCTC -3'
(R):5'- CCTGGGATGATAAAGTCTATCTGATC -3'
Posted On2019-06-07