Incidental Mutation 'PIT4520001:Coil'
ID555189
Institutional Source Beutler Lab
Gene Symbol Coil
Ensembl Gene ENSMUSG00000033983
Gene Namecoilin
SynonymsCln80, p80-coilin
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #PIT4520001 (G1)
Quality Score155.008
Status Not validated
Chromosome11
Chromosomal Location88970252-88991613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 88981611 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 266 (M266T)
Ref Sequence ENSEMBL: ENSMUSP00000047588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]
Predicted Effect probably benign
Transcript: ENSMUST00000036649
AA Change: M266T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: M266T

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 161 167 N/A INTRINSIC
low complexity region 174 195 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 401 417 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107898
AA Change: M266T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: M266T

DomainStartEndE-ValueType
Pfam:Coilin_N 10 220 8.7e-35 PFAM
low complexity region 303 325 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 91.1%
  • 10x: 86.1%
  • 20x: 75.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy1 A G 11: 7,167,133 N1000S probably damaging Het
Adgrb1 A G 15: 74,541,659 D564G probably damaging Het
Ankmy2 A G 12: 36,157,391 E12G probably benign Het
Arid1a C T 4: 133,681,916 S1375N unknown Het
Atp1a2 G A 1: 172,279,374 A793V probably benign Het
Atp8b1 T C 18: 64,568,180 Y369C probably benign Het
Catsperg2 A G 7: 29,710,161 Y536H possibly damaging Het
Ccdc178 A G 18: 22,067,413 Y445H probably damaging Het
Cep170 G T 1: 176,780,199 N230K unknown Het
Cftr A G 6: 18,277,843 I977V probably benign Het
Chek2 A G 5: 110,863,329 Y331C probably damaging Het
Chst13 A T 6: 90,309,185 I265K probably benign Het
Col16a1 T A 4: 130,051,663 C28S unknown Het
Col3a1 T C 1: 45,335,783 probably null Het
Csmd1 C T 8: 15,906,023 V3395M probably benign Het
Cyp51 A G 5: 4,101,200 V143A probably damaging Het
Eif2ak1 C T 5: 143,899,209 Q573* probably null Het
Eif2ak4 T A 2: 118,462,327 I1344N probably damaging Het
Fam160a1 G A 3: 85,672,472 Q809* probably null Het
Gen1 A G 12: 11,241,508 V825A probably benign Het
Gm28042 A T 2: 120,039,667 K696* probably null Het
Gm4952 A G 19: 12,624,684 Y152C probably benign Het
Hdac3 G A 18: 37,941,764 T308I probably damaging Het
Hpx T C 7: 105,592,134 T357A probably benign Het
Hscb A T 5: 110,835,985 Y139N probably damaging Het
Kcnk9 T A 15: 72,512,483 H282L probably benign Het
Kdm2b G A 5: 122,941,047 T287M probably damaging Het
Kif19a C T 11: 114,781,208 T207M probably damaging Het
Kmt2c A C 5: 25,315,666 N1815K probably benign Het
Ktn1 C T 14: 47,686,317 T511M probably damaging Het
Lrp1 C G 10: 127,607,974 Q141H possibly damaging Het
Lrrc43 T C 5: 123,492,467 V131A possibly damaging Het
Man1b1 T A 2: 25,343,270 H218Q probably damaging Het
Mapk8ip2 T A 15: 89,460,697 C766S probably damaging Het
Mfn1 A G 3: 32,561,546 N353D probably benign Het
Mtcl1 A T 17: 66,385,912 L474Q possibly damaging Het
Mtr T A 13: 12,197,985 R915* probably null Het
Myh6 C A 14: 54,950,124 V1263L probably benign Het
Nt5m C A 11: 59,874,589 L148M probably benign Het
Olfr1053 T C 2: 86,314,798 I163V possibly damaging Het
Olfr1200 A G 2: 88,767,577 V246A possibly damaging Het
Olfr574 A T 7: 102,948,714 D83V probably damaging Het
Pbrm1 T A 14: 31,067,861 F811I probably damaging Het
Pcnt A G 10: 76,420,235 S724P probably damaging Het
Pfdn5 C A 15: 102,328,723 D98E probably benign Het
Ptprs G A 17: 56,414,980 P1715S probably damaging Het
Rtkn2 T A 10: 67,987,461 L65Q probably damaging Het
Scn2a G A 2: 65,688,419 R379H probably damaging Het
Scn5a G T 9: 119,534,570 D501E possibly damaging Het
Spn C A 7: 127,136,439 G299W probably damaging Het
St6galnac1 T C 11: 116,769,349 N46S probably benign Het
Stx19 A G 16: 62,822,508 D229G probably benign Het
Tmc6 A T 11: 117,772,730 M552K possibly damaging Het
Tnpo3 G C 6: 29,555,222 D787E possibly damaging Het
Tyw5 T C 1: 57,388,515 Y310C probably damaging Het
Vmn2r15 A G 5: 109,287,005 F611S probably damaging Het
Vmn2r49 C T 7: 9,989,061 M95I probably benign Het
Wfdc8 A G 2: 164,603,303 S131P probably benign Het
Zfp407 A T 18: 84,432,420 M1597K probably damaging Het
Other mutations in Coil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Coil APN 11 88981754 missense probably benign 0.02
PIT4519001:Coil UTSW 11 88972726 start gained probably benign
R0122:Coil UTSW 11 88985007 splice site probably benign
R0211:Coil UTSW 11 88982153 missense probably damaging 1.00
R0288:Coil UTSW 11 88981868 missense probably damaging 1.00
R0396:Coil UTSW 11 88981623 missense probably benign
R0416:Coil UTSW 11 88981986 missense possibly damaging 0.55
R1251:Coil UTSW 11 88982299 missense possibly damaging 0.93
R1481:Coil UTSW 11 88974060 missense possibly damaging 0.87
R1705:Coil UTSW 11 88974136 missense probably damaging 1.00
R1728:Coil UTSW 11 88973976 missense probably damaging 0.98
R1824:Coil UTSW 11 88982097 missense possibly damaging 0.91
R2989:Coil UTSW 11 88987979 missense probably damaging 1.00
R3819:Coil UTSW 11 88981793 missense probably benign 0.07
R5217:Coil UTSW 11 88981161 missense possibly damaging 0.94
R6997:Coil UTSW 11 88981847 missense probably benign
R7050:Coil UTSW 11 88981188 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- GGCCTCCAAGTCTTCCAAAC -3'
(R):5'- GAGCATGTTCTTGGACACCAG -3'

Sequencing Primer
(F):5'- GTCTTCCAAACAACAGACGCCTAAAG -3'
(R):5'- GGAACTGGTCTTCCGACTCTGAAC -3'
Posted On2019-06-07