Incidental Mutation 'PIT4453001:Srek1'
ID555350
Institutional Source Beutler Lab
Gene Symbol Srek1
Ensembl Gene ENSMUSG00000032621
Gene Namesplicing regulatory glutamine/lysine-rich protein 1
SynonymsSRrp508, Sfrs12, SRrp86
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.948) question?
Stock #PIT4453001 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location103739348-103774608 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 103744783 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074616] [ENSMUST00000210489]
Predicted Effect probably null
Transcript: ENSMUST00000074616
SMART Domains Protein: ENSMUSP00000074196
Gene: ENSMUSG00000032621

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
RRM 70 141 1.22e-18 SMART
coiled coil region 259 298 N/A INTRINSIC
low complexity region 356 395 N/A INTRINSIC
low complexity region 397 408 N/A INTRINSIC
low complexity region 414 427 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000210489
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.9%
  • 10x: 85.6%
  • 20x: 74.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of serine/arginine-rich (SR) splicing proteins containing RNA recognition motif (RRM) domains. The encoded protein interacts with other SR proteins to modulate splice site selection. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T G 3: 122,105,316 I649S probably damaging Het
Abcc2 T A 19: 43,803,782 L334* probably null Het
Adam28 A T 14: 68,634,876 S306T probably benign Het
Adam34 T A 8: 43,651,312 D432V probably damaging Het
Adcy7 A G 8: 88,323,636 Y723C probably benign Het
Adgre5 T A 8: 83,724,460 M713L probably benign Het
Aebp2 C A 6: 140,637,686 C295* probably null Het
Amn1 G T 6: 149,170,859 Q127K probably benign Het
Atcay C T 10: 81,210,549 V314M probably damaging Het
Atp1a1 T C 3: 101,581,179 E847G probably benign Het
Atp2b1 A G 10: 99,016,978 E1039G probably benign Het
Caskin1 A G 17: 24,499,292 Y292C probably damaging Het
Cftr A G 6: 18,214,106 T94A probably damaging Het
Ciart T A 3: 95,880,476 K182M probably damaging Het
Col1a2 A C 6: 4,527,079 S603R possibly damaging Het
Cspp1 C A 1: 10,074,872 S298R possibly damaging Het
Cul7 T A 17: 46,651,820 C126S probably damaging Het
Cyp2c55 A T 19: 39,011,791 I145F probably damaging Het
Cypt4 G C 9: 24,625,474 A87P probably damaging Het
Disp2 G A 2: 118,787,644 V224M probably benign Het
Dlgap5 TTC T 14: 47,401,522 probably null Het
Dock1 A G 7: 135,152,300 K1602R probably benign Het
Ears2 T C 7: 122,048,339 I241V probably benign Het
Eml6 T C 11: 29,802,489 T975A probably damaging Het
Ephb2 T C 4: 136,660,810 T660A probably benign Het
Fbxw7 G A 3: 84,965,314 V268M Het
Gart A G 16: 91,636,538 F289S probably damaging Het
Gmcl1 G T 6: 86,704,538 N391K probably benign Het
Greb1l A C 18: 10,533,031 Q975P probably damaging Het
Greb1l G T 18: 10,533,032 Q975H probably benign Het
Grik5 C A 7: 25,010,694 R872L probably damaging Het
Hmox2 T A 16: 4,765,057 I218N probably damaging Het
Hook1 A T 4: 96,014,852 D526V probably damaging Het
Ifna4 A T 4: 88,841,954 N32Y probably damaging Het
Ighg2b T A 12: 113,306,872 N213Y unknown Het
Itih4 G A 14: 30,901,170 V900I probably benign Het
Itpr2 A T 6: 146,373,173 F837Y probably damaging Het
Kif3a T C 11: 53,579,114 V147A probably benign Het
Klra9 T A 6: 130,191,321 probably benign Het
Lamp3 G T 16: 19,673,460 Q345K probably benign Het
Ltbp3 G A 19: 5,757,794 E1188K probably damaging Het
Med1 T A 11: 98,158,417 I518L probably benign Het
Mis18bp1 T C 12: 65,158,673 T242A probably damaging Het
Nemp1 T A 10: 127,696,254 F392Y probably benign Het
Obscn C A 11: 59,060,976 G3984W probably damaging Het
Obscn T A 11: 59,069,834 H3217L possibly damaging Het
Olfr1157 C T 2: 87,962,458 V145M possibly damaging Het
Olfr1328 A G 4: 118,934,626 M74T probably benign Het
Olfr1532-ps1 C T 7: 106,914,929 H244Y probably damaging Het
Olfr709-ps1 T C 7: 106,926,842 I206V probably benign Het
Olfr71 A G 4: 43,706,464 Y35H probably damaging Het
P4ha1 G T 10: 59,350,472 A258S probably benign Het
Parn T C 16: 13,607,281 I423V probably benign Het
Pcdh20 C A 14: 88,467,308 S852I probably damaging Het
Pcnx3 A G 19: 5,672,756 probably null Het
Pcsk1 A T 13: 75,112,650 I331F probably damaging Het
Pkd1l2 G T 8: 117,022,022 S1803R probably benign Het
Pkd1l3 C A 8: 109,660,801 N1792K probably damaging Het
Plekhg1 C A 10: 3,963,469 Q1119K Het
Prr30 T A 14: 101,198,935 T64S probably benign Het
Rec114 T C 9: 58,660,370 N111S probably benign Het
Reck G A 4: 43,895,850 V79I probably benign Het
Rexo1 A G 10: 80,550,397 F276L probably damaging Het
Rgs6 T C 12: 83,091,779 Y296H probably damaging Het
Sdk1 A G 5: 142,212,038 R2149G probably benign Het
Slc20a2 C A 8: 22,535,382 F33L probably damaging Het
Spopl T A 2: 23,545,449 T25S probably damaging Het
Srcap A T 7: 127,549,320 I1947F possibly damaging Het
St8sia1 C T 6: 142,829,252 W200* probably null Het
Tas2r106 A T 6: 131,678,502 F129I possibly damaging Het
Tbrg4 A T 11: 6,620,857 L205Q probably damaging Het
Tchh C A 3: 93,445,880 R876S unknown Het
Thap12 G T 7: 98,715,038 A138S probably benign Het
Tjp1 C T 7: 65,343,614 probably null Het
Traf4 G A 11: 78,161,534 P95L probably benign Het
Trappc9 ATCTC ATCTCTC 15: 73,031,598 probably null Het
Usp20 G A 2: 31,017,486 V677M possibly damaging Het
Usp50 C A 2: 126,783,316 probably benign Het
Vmn1r21 T C 6: 57,844,322 T46A probably benign Het
Vmn2r54 T A 7: 12,629,742 H408L probably benign Het
Zfp266 T C 9: 20,506,003 T30A probably benign Het
Zfp536 T C 7: 37,479,757 H1141R probably benign Het
Other mutations in Srek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01756:Srek1 APN 13 103760582 missense probably damaging 1.00
IGL01834:Srek1 APN 13 103748785 unclassified probably benign
IGL03029:Srek1 APN 13 103763960 utr 5 prime probably benign
IGL03198:Srek1 APN 13 103744935 splice site probably null
IGL03284:Srek1 APN 13 103760537 missense probably damaging 0.96
inscruitable UTSW 13 103774386 missense probably damaging 1.00
R0080:Srek1 UTSW 13 103743686 missense unknown
R0082:Srek1 UTSW 13 103743686 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0106:Srek1 UTSW 13 103743623 missense unknown
R0506:Srek1 UTSW 13 103760590 missense probably damaging 0.99
R0569:Srek1 UTSW 13 103748862 unclassified probably benign
R0969:Srek1 UTSW 13 103752503 unclassified probably benign
R1617:Srek1 UTSW 13 103743604 missense unknown
R2098:Srek1 UTSW 13 103744855 missense unknown
R2423:Srek1 UTSW 13 103753028 nonsense probably null
R3950:Srek1 UTSW 13 103744895 missense unknown
R4347:Srek1 UTSW 13 103748759 missense probably null
R4676:Srek1 UTSW 13 103758187 splice site probably benign
R4915:Srek1 UTSW 13 103752563 unclassified probably benign
R4915:Srek1 UTSW 13 103752686 utr 3 prime probably benign
R5119:Srek1 UTSW 13 103752556 unclassified probably benign
R5677:Srek1 UTSW 13 103759244 missense probably damaging 0.98
R6135:Srek1 UTSW 13 103774386 missense probably damaging 1.00
R6458:Srek1 UTSW 13 103743568 missense probably benign 0.01
R7406:Srek1 UTSW 13 103769382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGAGGTTTTCTAAAATTTCCTCC -3'
(R):5'- TCAAGAGTTTAGAGAGTAGGTCTTC -3'

Sequencing Primer
(F):5'- AGGTTTTCTAAAATTTCCTCCTTGTG -3'
(R):5'- ACCACATCAGTGACAGG -3'
Posted On2019-06-07