Incidental Mutation 'PIT4445001:Asic4'
ID555369
Institutional Source Beutler Lab
Gene Symbol Asic4
Ensembl Gene ENSMUSG00000033007
Gene Nameacid-sensing (proton-gated) ion channel family member 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score126.008
Status Not validated
Chromosome1
Chromosomal Location75450436-75474343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75451127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 99 (V99A)
Ref Sequence ENSEMBL: ENSMUSP00000109207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037708] [ENSMUST00000113577]
Predicted Effect probably benign
Transcript: ENSMUST00000037708
AA Change: V99A

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000045598
Gene: ENSMUSG00000033007
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 464 5.3e-92 PFAM
low complexity region 507 533 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113577
AA Change: V99A

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000109207
Gene: ENSMUSG00000033007
AA Change: V99A

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
Pfam:ASC 45 346 5.5e-94 PFAM
Pfam:ASC 344 446 1.4e-42 PFAM
low complexity region 488 514 N/A INTRINSIC
Meta Mutation Damage Score 0.056 question?
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the superfamily of acid-sensing ion channels, which are proton-gated, amiloride-sensitive sodium channels. These channels have been implicated in synaptic transmission, pain perception as well as mechanoperception. This gene is predominantly expressed in the pituitary gland, and was considered a candidate for paroxysmal dystonic choreoathetosis (PDC), a movement disorder, however, no correlation was found between mutations in this gene and PDC. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous knockout increases the fear response in the predator-odor induced fear test and increases anxiety in open field and elevated plus maze tests. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Ppp1r3a A G 6: 14,717,777 F1046S probably damaging Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Asic4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Asic4 APN 1 75469146 missense possibly damaging 0.94
IGL01470:Asic4 APN 1 75450866 missense probably damaging 1.00
IGL02645:Asic4 APN 1 75473354 unclassified probably benign
IGL03002:Asic4 APN 1 75451323 missense possibly damaging 0.61
positron UTSW 1 75473043 nonsense probably null
R0106:Asic4 UTSW 1 75451127 missense probably benign 0.03
R0138:Asic4 UTSW 1 75469687 missense possibly damaging 0.87
R0453:Asic4 UTSW 1 75473511 unclassified probably benign
R0573:Asic4 UTSW 1 75469102 splice site probably benign
R0705:Asic4 UTSW 1 75451370 missense probably damaging 1.00
R1892:Asic4 UTSW 1 75469482 missense probably damaging 1.00
R1912:Asic4 UTSW 1 75469232 missense possibly damaging 0.93
R3614:Asic4 UTSW 1 75473058 missense probably damaging 1.00
R3790:Asic4 UTSW 1 75469841 unclassified probably benign
R3923:Asic4 UTSW 1 75451227 missense probably damaging 1.00
R4447:Asic4 UTSW 1 75470370 unclassified probably benign
R5177:Asic4 UTSW 1 75450839 missense probably damaging 1.00
R5208:Asic4 UTSW 1 75451226 missense probably damaging 1.00
R5266:Asic4 UTSW 1 75450923 missense probably benign 0.03
R5436:Asic4 UTSW 1 75451319 missense probably benign 0.09
R5921:Asic4 UTSW 1 75451373 missense probably benign 0.30
R6086:Asic4 UTSW 1 75473243 missense possibly damaging 0.64
R6512:Asic4 UTSW 1 75473043 nonsense probably null
R6530:Asic4 UTSW 1 75472335 missense probably damaging 0.98
R7545:Asic4 UTSW 1 75472416 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGAGGAGGATGCAAAACCC -3'
(R):5'- TACCATGTCAGGCTCTGGATAG -3'

Sequencing Primer
(F):5'- ATGAACAGAGCCTCCTGGG -3'
(R):5'- TGTCAGGCTCTGGATAGCGAAG -3'
Posted On2019-06-07