Incidental Mutation 'PIT4445001:Ppp1r3a'
ID555403
Institutional Source Beutler Lab
Gene Symbol Ppp1r3a
Ensembl Gene ENSMUSG00000042717
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 3A
SynonymsRGL, GM
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4445001 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location14713977-14755274 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14717777 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 1046 (F1046S)
Ref Sequence ENSEMBL: ENSMUSP00000049054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045096]
Predicted Effect probably damaging
Transcript: ENSMUST00000045096
AA Change: F1046S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049054
Gene: ENSMUSG00000042717
AA Change: F1046S

DomainStartEndE-ValueType
low complexity region 37 51 N/A INTRINSIC
Pfam:CBM_21 124 231 2.3e-32 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 636 646 N/A INTRINSIC
low complexity region 952 961 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.8%
  • 10x: 84.5%
  • 20x: 70.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycogen-associated form of protein phosphatase-1 (PP1) derived from skeletal muscle is a heterodimer composed of a 37-kD catalytic subunit and a 124-kD targeting and regulatory subunit. This gene encodes the regulatory subunit which binds to muscle glycogen with high affinity, thereby enhancing dephosphorylation of glycogen-bound substrates for PP1 such as glycogen synthase and glycogen phosphorylase kinase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have reduced levels of skeletal muscle glycogen. Whereas one model was normoglycemic and grossly normal, another on a similar genetic background was glucose intolerant, insulin resistant, and gained weight to the point of obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a T C 11: 110,075,551 K419E probably damaging Het
Adam7 T A 14: 68,509,748 K587N possibly damaging Het
Agl T C 3: 116,771,460 M382V Het
Agpat3 A T 10: 78,274,093 F341I possibly damaging Het
Ampd2 A T 3: 108,075,012 L767Q probably damaging Het
Arhgap28 A T 17: 67,896,235 D124E possibly damaging Het
Arhgap32 T C 9: 32,260,856 L1644P probably damaging Het
Asic4 T C 1: 75,451,127 V99A probably benign Het
Asns T A 6: 7,689,277 N75I probably damaging Het
Atp10a A G 7: 58,803,467 D798G probably damaging Het
Atp8a1 A G 5: 67,622,660 V1145A Het
BC017158 A G 7: 128,276,534 V243A probably benign Het
Ccdc171 A G 4: 83,661,747 Q577R probably damaging Het
Cd247 T A 1: 165,861,036 D154E probably damaging Het
Ceacam1 A T 7: 25,476,456 N104K probably damaging Het
Chfr A G 5: 110,151,677 D312G possibly damaging Het
Ddb1 C A 19: 10,625,970 L881I probably damaging Het
Dgkh A T 14: 78,575,942 I1032N possibly damaging Het
Efcab6 A T 15: 83,904,267 V942D probably benign Het
Fmo5 A G 3: 97,651,528 T435A probably benign Het
Fpr1 T C 17: 17,876,893 Q278R probably benign Het
Fzr1 C T 10: 81,369,394 W256* probably null Het
Gabrb1 T C 5: 72,108,782 S261P probably damaging Het
Galr2 G T 11: 116,281,648 A55S probably benign Het
Gbp2 A T 3: 142,637,466 K581N probably benign Het
Gm7682 T G 5: 94,448,507 W468G probably benign Het
Gria1 A T 11: 57,185,838 Y89F probably damaging Het
Ibsp T A 5: 104,302,304 I26N possibly damaging Het
Igf1r T C 7: 68,207,463 F1058L probably damaging Het
Ighv1-16 A C 12: 114,666,060 C36G probably benign Het
Igll1 T C 16: 16,860,919 T176A probably benign Het
Ilkap T C 1: 91,385,345 T143A probably benign Het
Kdm3b A T 18: 34,793,115 K103* probably null Het
Mphosph9 A G 5: 124,298,790 I497T possibly damaging Het
Mrgpra3 G A 7: 47,590,160 T6I possibly damaging Het
Mrpl38 T C 11: 116,132,558 probably null Het
Myo3a A T 2: 22,542,415 E813V possibly damaging Het
Myo7b G T 18: 31,959,466 Q2093K possibly damaging Het
Myo7b T C 18: 31,962,352 K1851R probably damaging Het
P3h2 T A 16: 25,984,999 D339V probably benign Het
Pcdhb6 C A 18: 37,335,247 P407Q possibly damaging Het
Plch2 C A 4: 155,009,026 R153L probably damaging Het
Plppr4 G A 3: 117,360,308 probably benign Het
Prkacb A T 3: 146,755,691 L107M probably benign Het
Ranbp17 A G 11: 33,481,020 probably null Het
Rasl11b C A 5: 74,197,333 P88Q probably damaging Het
Rcc2 A G 4: 140,721,149 E503G possibly damaging Het
Rnf216 T A 5: 143,086,003 K407N probably damaging Het
Scrn3 G A 2: 73,318,329 M81I possibly damaging Het
Scube2 T C 7: 109,809,180 T687A probably benign Het
Serpinb10 T A 1: 107,535,998 F3L probably benign Het
Sgcb C T 5: 73,639,812 V202I probably damaging Het
Sgce A G 6: 4,689,654 V429A possibly damaging Het
Sh3rf2 T C 18: 42,153,164 V574A probably benign Het
Sncaip T C 18: 52,868,944 L179S probably damaging Het
Sntg2 A T 12: 30,312,572 D58E probably damaging Het
Taar3 T C 10: 23,949,688 I44T possibly damaging Het
Tmem87b G A 2: 128,831,471 V227I probably benign Het
Tnfsf9 T C 17: 57,105,517 L29P possibly damaging Het
Tnip2 T C 5: 34,496,871 H391R probably benign Het
Traf5 A G 1: 191,997,807 Y125H Het
Ttc23 T G 7: 67,667,213 I77M probably damaging Het
Ube2l3 T C 16: 17,160,172 N43S probably benign Het
Vars2 A T 17: 35,666,211 C142* probably null Het
Vmn2r15 A C 5: 109,287,142 D565E probably damaging Het
Vmn2r56 C T 7: 12,715,226 probably null Het
Vmn2r79 A T 7: 87,002,200 D269V possibly damaging Het
Vmn2r85 A T 10: 130,425,703 M255K probably benign Het
Wfdc6a T A 2: 164,579,826 *137C probably null Het
Wipi2 T C 5: 142,666,884 V417A probably benign Het
Xirp2 G T 2: 67,509,772 V786L possibly damaging Het
Zdhhc13 G A 7: 48,795,949 G26S probably benign Het
Zscan25 T A 5: 145,290,612 V362D probably damaging Het
Other mutations in Ppp1r3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Ppp1r3a APN 6 14755084 missense probably damaging 1.00
IGL00670:Ppp1r3a APN 6 14719060 missense probably benign 0.22
IGL00703:Ppp1r3a APN 6 14718408 missense probably benign 0.02
IGL00726:Ppp1r3a APN 6 14717852 missense probably benign 0.42
IGL00742:Ppp1r3a APN 6 14718609 missense probably benign 0.36
IGL01477:Ppp1r3a APN 6 14718346 missense probably damaging 0.99
IGL01632:Ppp1r3a APN 6 14754811 missense probably damaging 1.00
IGL02162:Ppp1r3a APN 6 14717715 missense probably damaging 1.00
IGL02374:Ppp1r3a APN 6 14718600 missense probably damaging 1.00
IGL02539:Ppp1r3a APN 6 14718459 missense probably benign 0.01
IGL02563:Ppp1r3a APN 6 14719762 missense probably benign 0.20
IGL02929:Ppp1r3a APN 6 14719811 missense probably benign 0.00
IGL03110:Ppp1r3a APN 6 14722065 splice site probably benign
IGL03290:Ppp1r3a APN 6 14754772 missense probably damaging 1.00
IGL03326:Ppp1r3a APN 6 14719766 missense probably damaging 0.96
P0041:Ppp1r3a UTSW 6 14719697 missense probably benign 0.00
R0015:Ppp1r3a UTSW 6 14717661 missense possibly damaging 0.58
R0077:Ppp1r3a UTSW 6 14754517 missense possibly damaging 0.64
R0368:Ppp1r3a UTSW 6 14718960 missense probably benign 0.26
R0391:Ppp1r3a UTSW 6 14719697 missense probably benign 0.43
R1793:Ppp1r3a UTSW 6 14754718 missense probably damaging 1.00
R1797:Ppp1r3a UTSW 6 14717982 missense probably benign 0.02
R1855:Ppp1r3a UTSW 6 14754994 missense probably damaging 1.00
R1864:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R1865:Ppp1r3a UTSW 6 14718405 missense probably damaging 1.00
R2046:Ppp1r3a UTSW 6 14722104 missense probably benign 0.12
R2122:Ppp1r3a UTSW 6 14721875 missense possibly damaging 0.95
R2437:Ppp1r3a UTSW 6 14718323 missense probably benign 0.03
R2518:Ppp1r3a UTSW 6 14719378 missense possibly damaging 0.95
R2887:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2888:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R2889:Ppp1r3a UTSW 6 14718249 missense possibly damaging 0.89
R3419:Ppp1r3a UTSW 6 14719414 missense probably benign 0.01
R3886:Ppp1r3a UTSW 6 14719912 missense possibly damaging 0.87
R3937:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R3938:Ppp1r3a UTSW 6 14719074 missense probably damaging 0.99
R4246:Ppp1r3a UTSW 6 14719781 missense probably damaging 1.00
R4561:Ppp1r3a UTSW 6 14754682 missense probably damaging 1.00
R4701:Ppp1r3a UTSW 6 14718993 missense probably benign 0.00
R4853:Ppp1r3a UTSW 6 14719047 missense probably benign 0.03
R5076:Ppp1r3a UTSW 6 14754681 missense probably damaging 1.00
R5085:Ppp1r3a UTSW 6 14719604 missense probably damaging 1.00
R5501:Ppp1r3a UTSW 6 14719418 missense probably benign 0.02
R5725:Ppp1r3a UTSW 6 14719349 missense probably benign 0.04
R5729:Ppp1r3a UTSW 6 14719763 missense probably benign 0.06
R5741:Ppp1r3a UTSW 6 14719883 missense probably damaging 0.97
R5841:Ppp1r3a UTSW 6 14718984 missense probably benign 0.26
R5914:Ppp1r3a UTSW 6 14718989 missense probably benign 0.09
R6091:Ppp1r3a UTSW 6 14719340 missense probably benign 0.02
R6154:Ppp1r3a UTSW 6 14754604 missense possibly damaging 0.88
R6218:Ppp1r3a UTSW 6 14718431 missense probably damaging 0.99
R6813:Ppp1r3a UTSW 6 14719571 missense probably benign 0.13
R6826:Ppp1r3a UTSW 6 14718981 nonsense probably null
R6869:Ppp1r3a UTSW 6 14754826 missense probably benign 0.39
R7109:Ppp1r3a UTSW 6 14719236 missense probably benign 0.00
R7188:Ppp1r3a UTSW 6 14719191 missense probably benign 0.00
R7262:Ppp1r3a UTSW 6 14719070 missense probably benign 0.04
R7341:Ppp1r3a UTSW 6 14718750 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AATGAATAGTCTCTCCTGCCATTC -3'
(R):5'- CCTCTTGAGAATCTGGATGAAGC -3'

Sequencing Primer
(F):5'- AATAGTCTCTCCTGCCATTCCAAATG -3'
(R):5'- CTTGAGAATCTGGATGAAGCAAGTTC -3'
Posted On2019-06-07