Incidental Mutation 'PIT4403001:Zfp335'
ID555455
Institutional Source Beutler Lab
Gene Symbol Zfp335
Ensembl Gene ENSMUSG00000039834
Gene Namezinc finger protein 335
Synonyms1810045J01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4403001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location164891882-164911757 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 164893716 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1106 (H1106R)
Ref Sequence ENSEMBL: ENSMUSP00000038298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041361] [ENSMUST00000041643] [ENSMUST00000183830]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041361
AA Change: H1106R

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000038298
Gene: ENSMUSG00000039834
AA Change: H1106R

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
ZnF_C2H2 591 613 2.53e-2 SMART
ZnF_C2H2 622 644 6.78e-3 SMART
ZnF_C2H2 650 673 8.22e-2 SMART
ZnF_C2H2 679 702 3.29e-1 SMART
low complexity region 711 726 N/A INTRINSIC
internal_repeat_3 770 937 7.16e-5 PROSPERO
low complexity region 1005 1015 N/A INTRINSIC
ZnF_C2H2 1019 1041 2.95e-3 SMART
ZnF_C2H2 1047 1069 5.5e-3 SMART
ZnF_C2H2 1075 1097 1.58e-3 SMART
ZnF_C2H2 1103 1126 3.34e-2 SMART
low complexity region 1288 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000041643
SMART Domains Protein: ENSMUSP00000039555
Gene: ENSMUSG00000039849

DomainStartEndE-ValueType
WW 44 77 4.34e-4 SMART
low complexity region 132 148 N/A INTRINSIC
Pfam:PCIF1_WW 445 620 7.1e-74 PFAM
low complexity region 675 686 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183830
SMART Domains Protein: ENSMUSP00000139133
Gene: ENSMUSG00000039834

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C2H2 248 271 4.24e-4 SMART
low complexity region 275 282 N/A INTRINSIC
low complexity region 300 321 N/A INTRINSIC
low complexity region 340 365 N/A INTRINSIC
low complexity region 435 445 N/A INTRINSIC
ZnF_C2H2 466 488 2.17e-1 SMART
ZnF_C2H2 496 518 1.56e-2 SMART
ZnF_C2H2 524 546 8.81e-2 SMART
ZnF_C2H2 563 585 2.79e-4 SMART
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.9%
  • 20x: 73.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene enhances transcriptional activation by ligand-bound nuclear hormone receptors. However, it does this not by direct interaction with the receptor, but by direct interaction with the nuclear hormone receptor transcriptional coactivator NRC. The encoded protein may function by altering local chromatin structure. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. Mice homozygous for a conditional allele activated in the brain exhibit loss of cortical neurons and decreased brain size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,744 N253D probably benign Het
Adh4 T C 3: 138,424,178 V255A probably damaging Het
Ahnak T C 19: 9,006,176 I1608T possibly damaging Het
Atm A T 9: 53,500,982 D955E probably benign Het
Cacybp A G 1: 160,206,194 S113P probably damaging Het
Cenpu C T 8: 46,562,529 P160S possibly damaging Het
Clstn3 C T 6: 124,458,023 G348D probably damaging Het
Cmtr1 T G 17: 29,698,073 probably null Het
Dlgap2 T C 8: 14,831,528 S867P probably damaging Het
Fbn1 A T 2: 125,342,911 C1654S probably damaging Het
Fbxl3 G A 14: 103,095,464 T26M possibly damaging Het
Garnl3 A T 2: 32,990,758 L874Q probably damaging Het
Gcm2 A G 13: 41,102,839 V478A probably benign Het
Gm1527 T C 3: 28,917,985 I417T possibly damaging Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Ighv1-4 A G 12: 114,487,204 S95P probably damaging Het
Jak3 C T 8: 71,684,349 T723I probably benign Het
Jup A G 11: 100,378,087 probably null Het
Kcng3 A G 17: 83,588,182 L285S probably damaging Het
Kmt2b G A 7: 30,585,689 P593S probably damaging Het
Mstn T C 1: 53,061,785 M7T probably benign Het
Myh2 A T 11: 67,186,707 K889N probably benign Het
Myo5a A G 9: 75,217,523 T1787A probably damaging Het
Nlrp14 A T 7: 107,184,892 Q607L possibly damaging Het
Ntf3 C T 6: 126,101,826 R239Q probably damaging Het
Nup85 G T 11: 115,581,820 R492L probably damaging Het
Ogfod3 A C 11: 121,196,735 probably null Het
Olfr1220 T A 2: 89,097,076 M284L probably benign Het
Olfr1286 A T 2: 111,420,820 F44I probably benign Het
Olfr26 T C 9: 38,855,380 I106T probably benign Het
Olfr347 T A 2: 36,734,918 I199K probably damaging Het
Olfr649 A G 7: 104,189,460 V249A probably benign Het
Oxct2a A T 4: 123,322,444 D381E probably damaging Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pdgfc C T 3: 81,174,961 P154S probably damaging Het
Phkg1 T C 5: 129,865,931 T260A probably benign Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Plekhj1 C T 10: 80,796,459 D150N unknown Het
Plppr1 T G 4: 49,337,648 N316K probably benign Het
Pola2 A C 19: 5,959,046 S95A possibly damaging Het
Polq G A 16: 37,060,587 D1038N probably benign Het
Prim1 A T 10: 128,022,876 I218L probably benign Het
Prkcz A G 4: 155,293,156 probably null Het
Ptgr1 T C 4: 58,968,794 K282E probably benign Het
Rbm5 A G 9: 107,760,336 M132T probably damaging Het
Scn2a C T 2: 65,711,908 T785M probably damaging Het
Setx A G 2: 29,133,955 E141G probably damaging Het
Slc24a2 A G 4: 87,032,286 F425L probably benign Het
Smarcc2 A T 10: 128,463,024 H92L probably damaging Het
Tatdn1 C G 15: 58,905,747 E220Q probably damaging Het
Tmc7 C A 7: 118,547,400 Q488H probably benign Het
Tmc7 T G 7: 118,547,401 Q488P possibly damaging Het
Tmem45b C T 9: 31,426,892 D264N probably benign Het
Tmtc4 A C 14: 122,973,229 S72R probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Ubac1 A T 2: 26,006,597 M302K probably benign Het
Ubox5 A G 2: 130,600,677 I30T probably damaging Het
Vwce A G 19: 10,638,097 N114S possibly damaging Het
Xpo5 T A 17: 46,239,569 D992E probably benign Het
Zfhx2 G A 14: 55,074,980 P86S probably benign Het
Zfp653 T A 9: 22,065,757 Q166L probably damaging Het
Zp3r T A 1: 130,582,872 N436I possibly damaging Het
Other mutations in Zfp335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Zfp335 APN 2 164892382 missense probably damaging 1.00
IGL00921:Zfp335 APN 2 164894776 missense possibly damaging 0.51
IGL00980:Zfp335 APN 2 164902674 nonsense probably null
IGL01145:Zfp335 APN 2 164907502 missense probably benign 0.03
IGL01568:Zfp335 APN 2 164894788 missense possibly damaging 0.70
IGL01612:Zfp335 APN 2 164910620 critical splice donor site probably null
IGL02138:Zfp335 APN 2 164893804 missense probably damaging 1.00
IGL02675:Zfp335 APN 2 164910689 missense probably benign
IGL03206:Zfp335 APN 2 164892681 splice site probably benign
IGL03269:Zfp335 APN 2 164900354 missense probably damaging 1.00
IGL03306:Zfp335 APN 2 164895984 splice site probably benign
FR4342:Zfp335 UTSW 2 164907465 small insertion probably benign
FR4342:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907477 small insertion probably benign
FR4449:Zfp335 UTSW 2 164907483 small insertion probably benign
FR4548:Zfp335 UTSW 2 164907472 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907475 small insertion probably benign
FR4737:Zfp335 UTSW 2 164907484 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907474 small insertion probably benign
FR4976:Zfp335 UTSW 2 164907478 small insertion probably benign
R0005:Zfp335 UTSW 2 164909302 missense possibly damaging 0.91
R0101:Zfp335 UTSW 2 164899990 missense probably damaging 1.00
R0196:Zfp335 UTSW 2 164896145 missense possibly damaging 0.88
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0211:Zfp335 UTSW 2 164907692 missense probably damaging 1.00
R0533:Zfp335 UTSW 2 164907922 nonsense probably null
R0865:Zfp335 UTSW 2 164899495 splice site probably null
R1023:Zfp335 UTSW 2 164892585 missense possibly damaging 0.88
R1029:Zfp335 UTSW 2 164892678 splice site probably benign
R1052:Zfp335 UTSW 2 164907468 small deletion probably benign
R1106:Zfp335 UTSW 2 164907551 small deletion probably benign
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1146:Zfp335 UTSW 2 164896123 missense probably benign 0.01
R1274:Zfp335 UTSW 2 164907468 small deletion probably benign
R1386:Zfp335 UTSW 2 164898241 missense probably benign 0.00
R1433:Zfp335 UTSW 2 164899456 missense probably damaging 0.99
R1813:Zfp335 UTSW 2 164892605 missense probably damaging 0.99
R1959:Zfp335 UTSW 2 164894802 missense probably damaging 1.00
R2372:Zfp335 UTSW 2 164895039 missense probably damaging 1.00
R3847:Zfp335 UTSW 2 164900106 splice site probably null
R3937:Zfp335 UTSW 2 164910700 missense probably damaging 1.00
R3946:Zfp335 UTSW 2 164892189 missense probably damaging 1.00
R3979:Zfp335 UTSW 2 164910638 missense probably benign 0.00
R4019:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4020:Zfp335 UTSW 2 164901460 missense probably damaging 1.00
R4668:Zfp335 UTSW 2 164900286 missense probably damaging 1.00
R5000:Zfp335 UTSW 2 164894668 missense probably benign
R5038:Zfp335 UTSW 2 164910644 nonsense probably null
R5245:Zfp335 UTSW 2 164894758 missense probably benign
R5411:Zfp335 UTSW 2 164902245 missense probably damaging 0.99
R5422:Zfp335 UTSW 2 164907730 missense probably damaging 1.00
R5968:Zfp335 UTSW 2 164892394 missense probably damaging 0.99
R6056:Zfp335 UTSW 2 164895098 splice site probably null
R6551:Zfp335 UTSW 2 164909365 missense probably benign
R6927:Zfp335 UTSW 2 164893720 missense probably damaging 1.00
R6943:Zfp335 UTSW 2 164894875 missense possibly damaging 0.50
R6995:Zfp335 UTSW 2 164893290 nonsense probably null
R7174:Zfp335 UTSW 2 164902503 missense probably damaging 1.00
R7185:Zfp335 UTSW 2 164893244 critical splice donor site probably null
R7322:Zfp335 UTSW 2 164910821 start codon destroyed probably null 0.90
Predicted Primers PCR Primer
(F):5'- ATGGCCCAGGAGTAGCTTAC -3'
(R):5'- TCTGGTCCTCACTGACATGG -3'

Sequencing Primer
(F):5'- CCCAGGAGTAGCTTACTGTGTAG -3'
(R):5'- TCCTCACTGACATGGGTTTAG -3'
Posted On2019-06-07