Incidental Mutation 'PIT4403001:Smarcc2'
ID555486
Institutional Source Beutler Lab
Gene Symbol Smarcc2
Ensembl Gene ENSMUSG00000025369
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms5930405J04Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.871) question?
Stock #PIT4403001 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128459248-128490482 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128463024 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 92 (H92L)
Ref Sequence ENSEMBL: ENSMUSP00000100868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026433] [ENSMUST00000099131] [ENSMUST00000105235] [ENSMUST00000218228]
Predicted Effect probably damaging
Transcript: ENSMUST00000026433
AA Change: H92L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000026433
Gene: ENSMUSG00000025369
AA Change: H92L

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 4.9e-38 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
low complexity region 768 816 N/A INTRINSIC
low complexity region 861 879 N/A INTRINSIC
coiled coil region 906 921 N/A INTRINSIC
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1074 1098 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000099131
AA Change: H92L

PolyPhen 2 Score 0.932 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000096734
Gene: ENSMUSG00000025369
AA Change: H92L

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 424 512 3.9e-38 PFAM
SANT 628 676 9.04e-12 SMART
low complexity region 799 847 N/A INTRINSIC
low complexity region 892 910 N/A INTRINSIC
coiled coil region 937 952 N/A INTRINSIC
low complexity region 979 1013 N/A INTRINSIC
low complexity region 1016 1041 N/A INTRINSIC
low complexity region 1043 1093 N/A INTRINSIC
low complexity region 1105 1129 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105235
AA Change: H92L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100868
Gene: ENSMUSG00000025369
AA Change: H92L

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
CHROMO 186 235 5.97e-6 SMART
low complexity region 297 307 N/A INTRINSIC
Pfam:SWIRM 426 512 4.5e-35 PFAM
low complexity region 545 557 N/A INTRINSIC
SANT 597 645 9.04e-12 SMART
Pfam:SWIRM-assoc_3 684 750 4.1e-34 PFAM
low complexity region 768 816 N/A INTRINSIC
Pfam:SWIRM-assoc_1 863 946 1.5e-34 PFAM
low complexity region 948 982 N/A INTRINSIC
low complexity region 985 1010 N/A INTRINSIC
low complexity region 1012 1062 N/A INTRINSIC
low complexity region 1077 1093 N/A INTRINSIC
low complexity region 1108 1123 N/A INTRINSIC
low complexity region 1153 1177 N/A INTRINSIC
low complexity region 1184 1212 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218228
AA Change: H92L

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 92.7%
  • 3x: 90.5%
  • 10x: 84.9%
  • 20x: 73.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and contains a predicted leucine zipper motif typical of many transcription factors. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted allele exhibit a slight increase in embryo weight at E13.5 and die shortly after birth (P0-P3). Mice homozygous for a conditional allele activated in the brain exhibit reduced cerebral cortical size and thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931428F04Rik T C 8: 105,284,744 N253D probably benign Het
Adh4 T C 3: 138,424,178 V255A probably damaging Het
Ahnak T C 19: 9,006,176 I1608T possibly damaging Het
Atm A T 9: 53,500,982 D955E probably benign Het
Cacybp A G 1: 160,206,194 S113P probably damaging Het
Cenpu C T 8: 46,562,529 P160S possibly damaging Het
Clstn3 C T 6: 124,458,023 G348D probably damaging Het
Cmtr1 T G 17: 29,698,073 probably null Het
Dlgap2 T C 8: 14,831,528 S867P probably damaging Het
Fbn1 A T 2: 125,342,911 C1654S probably damaging Het
Fbxl3 G A 14: 103,095,464 T26M possibly damaging Het
Garnl3 A T 2: 32,990,758 L874Q probably damaging Het
Gcm2 A G 13: 41,102,839 V478A probably benign Het
Gm1527 T C 3: 28,917,985 I417T possibly damaging Het
Grip1 A G 10: 119,929,928 E55G probably damaging Het
Ighv1-4 A G 12: 114,487,204 S95P probably damaging Het
Jak3 C T 8: 71,684,349 T723I probably benign Het
Jup A G 11: 100,378,087 probably null Het
Kcng3 A G 17: 83,588,182 L285S probably damaging Het
Kmt2b G A 7: 30,585,689 P593S probably damaging Het
Mstn T C 1: 53,061,785 M7T probably benign Het
Myh2 A T 11: 67,186,707 K889N probably benign Het
Myo5a A G 9: 75,217,523 T1787A probably damaging Het
Nlrp14 A T 7: 107,184,892 Q607L possibly damaging Het
Ntf3 C T 6: 126,101,826 R239Q probably damaging Het
Nup85 G T 11: 115,581,820 R492L probably damaging Het
Ogfod3 A C 11: 121,196,735 probably null Het
Olfr1220 T A 2: 89,097,076 M284L probably benign Het
Olfr1286 A T 2: 111,420,820 F44I probably benign Het
Olfr26 T C 9: 38,855,380 I106T probably benign Het
Olfr347 T A 2: 36,734,918 I199K probably damaging Het
Olfr649 A G 7: 104,189,460 V249A probably benign Het
Oxct2a A T 4: 123,322,444 D381E probably damaging Het
Pcdh20 G C 14: 88,467,026 P946R probably damaging Het
Pdgfc C T 3: 81,174,961 P154S probably damaging Het
Phkg1 T C 5: 129,865,931 T260A probably benign Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Plekhj1 C T 10: 80,796,459 D150N unknown Het
Plppr1 T G 4: 49,337,648 N316K probably benign Het
Pola2 A C 19: 5,959,046 S95A possibly damaging Het
Polq G A 16: 37,060,587 D1038N probably benign Het
Prim1 A T 10: 128,022,876 I218L probably benign Het
Prkcz A G 4: 155,293,156 probably null Het
Ptgr1 T C 4: 58,968,794 K282E probably benign Het
Rbm5 A G 9: 107,760,336 M132T probably damaging Het
Scn2a C T 2: 65,711,908 T785M probably damaging Het
Setx A G 2: 29,133,955 E141G probably damaging Het
Slc24a2 A G 4: 87,032,286 F425L probably benign Het
Tatdn1 C G 15: 58,905,747 E220Q probably damaging Het
Tmc7 T G 7: 118,547,401 Q488P possibly damaging Het
Tmc7 C A 7: 118,547,400 Q488H probably benign Het
Tmem45b C T 9: 31,426,892 D264N probably benign Het
Tmtc4 A C 14: 122,973,229 S72R probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Ubac1 A T 2: 26,006,597 M302K probably benign Het
Ubox5 A G 2: 130,600,677 I30T probably damaging Het
Vwce A G 19: 10,638,097 N114S possibly damaging Het
Xpo5 T A 17: 46,239,569 D992E probably benign Het
Zfhx2 G A 14: 55,074,980 P86S probably benign Het
Zfp335 T C 2: 164,893,716 H1106R possibly damaging Het
Zfp653 T A 9: 22,065,757 Q166L probably damaging Het
Zp3r T A 1: 130,582,872 N436I possibly damaging Het
Other mutations in Smarcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Smarcc2 APN 10 128463055 missense probably damaging 0.97
IGL01450:Smarcc2 APN 10 128469320 missense probably damaging 1.00
IGL01638:Smarcc2 APN 10 128488074 unclassified probably benign
IGL01663:Smarcc2 APN 10 128488977 unclassified probably benign
IGL02308:Smarcc2 APN 10 128482772 missense probably damaging 1.00
IGL02511:Smarcc2 APN 10 128461382 missense probably damaging 1.00
IGL02633:Smarcc2 APN 10 128469687 missense probably damaging 1.00
IGL03375:Smarcc2 APN 10 128482912 missense probably damaging 0.99
IGL03493:Smarcc2 APN 10 128461357 missense probably damaging 1.00
R0220:Smarcc2 UTSW 10 128483636 missense probably benign 0.32
R0281:Smarcc2 UTSW 10 128474722 missense probably benign 0.20
R1299:Smarcc2 UTSW 10 128461378 missense probably damaging 1.00
R1447:Smarcc2 UTSW 10 128469791 critical splice donor site probably null
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1466:Smarcc2 UTSW 10 128474245 missense probably damaging 0.98
R1498:Smarcc2 UTSW 10 128482192 missense probably benign 0.02
R1499:Smarcc2 UTSW 10 128463872 missense probably damaging 0.99
R1616:Smarcc2 UTSW 10 128482793 missense probably damaging 1.00
R1718:Smarcc2 UTSW 10 128468998 intron probably benign
R1767:Smarcc2 UTSW 10 128469082 missense possibly damaging 0.92
R1792:Smarcc2 UTSW 10 128463871 missense probably damaging 1.00
R1965:Smarcc2 UTSW 10 128474758 missense probably damaging 1.00
R2229:Smarcc2 UTSW 10 128488341 unclassified probably benign
R2286:Smarcc2 UTSW 10 128463743 missense possibly damaging 0.58
R2367:Smarcc2 UTSW 10 128482167 missense possibly damaging 0.86
R2398:Smarcc2 UTSW 10 128469682 missense possibly damaging 0.92
R3084:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3085:Smarcc2 UTSW 10 128488159 unclassified probably benign
R3777:Smarcc2 UTSW 10 128482943 critical splice donor site probably null
R4346:Smarcc2 UTSW 10 128468823 missense probably benign 0.02
R4967:Smarcc2 UTSW 10 128483180 missense probably damaging 0.99
R4992:Smarcc2 UTSW 10 128474710 missense probably damaging 0.99
R5028:Smarcc2 UTSW 10 128461445 missense probably damaging 0.99
R5071:Smarcc2 UTSW 10 128463940 missense probably damaging 1.00
R5095:Smarcc2 UTSW 10 128469300 missense probably damaging 0.99
R5133:Smarcc2 UTSW 10 128461473 critical splice donor site probably null
R5180:Smarcc2 UTSW 10 128487362 unclassified probably benign
R5231:Smarcc2 UTSW 10 128461352 missense probably damaging 1.00
R5240:Smarcc2 UTSW 10 128481006 critical splice donor site probably null
R5401:Smarcc2 UTSW 10 128465504 missense probably damaging 1.00
R5445:Smarcc2 UTSW 10 128488074 unclassified probably benign
R5690:Smarcc2 UTSW 10 128484407 missense probably damaging 1.00
R5694:Smarcc2 UTSW 10 128484127 missense probably benign
R6240:Smarcc2 UTSW 10 128488024 unclassified probably benign
R6545:Smarcc2 UTSW 10 128484128 missense probably benign 0.00
R6713:Smarcc2 UTSW 10 128487769 intron probably null
R6934:Smarcc2 UTSW 10 128469672 missense probably benign 0.27
R7016:Smarcc2 UTSW 10 128485329 intron probably null
R7149:Smarcc2 UTSW 10 128482729 missense probably damaging 1.00
R7229:Smarcc2 UTSW 10 128488048 missense unknown
R7395:Smarcc2 UTSW 10 128485606 missense probably damaging 1.00
Z1088:Smarcc2 UTSW 10 128461434 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTAAAAGGAGGCACTGGAATTTAG -3'
(R):5'- AAATGCGTGAGTCACTCCAC -3'

Sequencing Primer
(F):5'- AGGCACTGGAATTTAGATTTGC -3'
(R):5'- GGAGACTACTTTGGCCATGACATC -3'
Posted On2019-06-07