Incidental Mutation 'PIT4402001:Pccb'
ID555530
Institutional Source Beutler Lab
Gene Symbol Pccb
Ensembl Gene ENSMUSG00000032527
Gene Namepropionyl Coenzyme A carboxylase, beta polypeptide
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4402001 (G1)
Quality Score136.008
Status Not validated
Chromosome9
Chromosomal Location100982032-101034898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 100995592 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 286 (D286E)
Ref Sequence ENSEMBL: ENSMUSP00000035116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035116] [ENSMUST00000142676] [ENSMUST00000149322]
Predicted Effect probably benign
Transcript: ENSMUST00000035116
AA Change: D286E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000035116
Gene: ENSMUSG00000032527
AA Change: D286E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 539 6.2e-197 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142676
AA Change: D246E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000123421
Gene: ENSMUSG00000032527
AA Change: D246E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 52 256 3.2e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149322
AA Change: D249E

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000118006
Gene: ENSMUSG00000032527
AA Change: D249E

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Carboxyl_trans 59 187 2.3e-45 PFAM
Pfam:Carboxyl_trans 183 502 2.7e-127 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the propionyl-CoA carboxylase (PCC) enzyme, which is involved in the catabolism of propionyl-CoA. PCC is a mitochondrial enzyme that probably acts as a dodecamer of six alpha subunits and six beta subunits. This gene encodes the beta subunit of PCC. Defects in this gene are a cause of propionic acidemia type II (PA-2). Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Pccb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00939:Pccb APN 9 100985869 missense probably damaging 1.00
IGL02101:Pccb APN 9 100987841 missense possibly damaging 0.53
IGL02149:Pccb APN 9 100985190 missense probably damaging 1.00
IGL02938:Pccb APN 9 100984396 missense probably benign 0.35
R0446:Pccb UTSW 9 100982797 missense probably damaging 1.00
R2128:Pccb UTSW 9 100985831 missense probably damaging 1.00
R2292:Pccb UTSW 9 100994632 missense probably benign
R3056:Pccb UTSW 9 101030197 missense probably damaging 1.00
R4574:Pccb UTSW 9 100985199 missense probably damaging 1.00
R4600:Pccb UTSW 9 101034779 missense probably benign
R5087:Pccb UTSW 9 100985243 intron probably benign
R5219:Pccb UTSW 9 100985209 nonsense probably null
R5586:Pccb UTSW 9 100985803 missense possibly damaging 0.87
R5724:Pccb UTSW 9 100987847 missense probably benign 0.02
R6813:Pccb UTSW 9 101023215 missense probably damaging 1.00
R6982:Pccb UTSW 9 101023296 intron probably null
R7253:Pccb UTSW 9 101031913 missense probably benign 0.01
R7535:Pccb UTSW 9 100994562 splice site probably null
Predicted Primers PCR Primer
(F):5'- AAAATCTTGTGGTCTCTCCTGC -3'
(R):5'- CTGGTGAAGCCCATGAACATC -3'

Sequencing Primer
(F):5'- TAGAGCGACCCATCAGAGACTAG -3'
(R):5'- GGTGAAGCCCATGAACATCTACATAC -3'
Posted On2019-06-07