Incidental Mutation 'PIT4402001:Plek'
ID555536
Institutional Source Beutler Lab
Gene Symbol Plek
Ensembl Gene ENSMUSG00000020120
Gene Namepleckstrin
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.175) question?
Stock #PIT4402001 (G1)
Quality Score198.009
Status Not validated
Chromosome11
Chromosomal Location16971206-17052381 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 16990121 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 196 (L196R)
Ref Sequence ENSEMBL: ENSMUSP00000099945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020321] [ENSMUST00000102881] [ENSMUST00000156101]
PDB Structure
Solution structure of the DEP domain of mouse pleckstrin [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000020321
AA Change: L173R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020321
Gene: ENSMUSG00000020120
AA Change: L173R

DomainStartEndE-ValueType
PH 1 80 1.12e-2 SMART
DEP 113 198 2.53e-16 SMART
PH 222 326 5.96e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102881
AA Change: L196R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099945
Gene: ENSMUSG00000020120
AA Change: L196R

DomainStartEndE-ValueType
PH 5 103 7.12e-19 SMART
DEP 136 221 2.53e-16 SMART
PH 245 349 5.96e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156101
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display mild thrombocytopenia, impaired platelet aggregation, and impaired platelet granule secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Plek
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02350:Plek APN 11 16981846 missense probably damaging 1.00
IGL02357:Plek APN 11 16981846 missense probably damaging 1.00
IGL02982:Plek APN 11 16981826 missense probably damaging 1.00
IGL03184:Plek APN 11 16981887 missense probably benign
IGL03243:Plek APN 11 16995319 missense possibly damaging 0.47
R0025:Plek UTSW 11 16985594 missense probably damaging 1.00
R1756:Plek UTSW 11 16992901 missense probably damaging 1.00
R1881:Plek UTSW 11 16990111 missense probably benign 0.08
R2940:Plek UTSW 11 16992887 critical splice donor site probably null
R3426:Plek UTSW 11 16990142 missense probably damaging 0.99
R4436:Plek UTSW 11 16992972 missense probably damaging 0.97
R4463:Plek UTSW 11 16981873 missense possibly damaging 0.95
R4475:Plek UTSW 11 16985528 critical splice donor site probably null
R4998:Plek UTSW 11 16983194 critical splice donor site probably null
R5050:Plek UTSW 11 16995216 missense probably damaging 0.98
R6108:Plek UTSW 11 16990058 missense probably damaging 0.98
R6159:Plek UTSW 11 16985539 missense probably damaging 0.96
R6185:Plek UTSW 11 16981829 missense probably damaging 1.00
R7011:Plek UTSW 11 16994760 missense possibly damaging 0.86
R7017:Plek UTSW 11 17052220 start gained probably benign
R7317:Plek UTSW 11 16994739 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGTCTCTTTACGACTAGACATTCTG -3'
(R):5'- CCAGATGGCCTTTTGTGTGC -3'

Sequencing Primer
(F):5'- CTAGACATTCTGTTTGAATATGTGGC -3'
(R):5'- CCTTTTGTGTGCACTGGAGTCAG -3'
Posted On2019-06-07