Incidental Mutation 'PIT4402001:Noxred1'
ID555540
Institutional Source Beutler Lab
Gene Symbol Noxred1
Ensembl Gene ENSMUSG00000072919
Gene NameNADP+ dependent oxidoreductase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location87221040-87238732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87227081 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 62 (I62K)
Ref Sequence ENSEMBL: ENSMUSP00000152486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021423] [ENSMUST00000221768] [ENSMUST00000222480]
Predicted Effect probably benign
Transcript: ENSMUST00000021423
AA Change: I62K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021423
Gene: ENSMUSG00000072919
AA Change: I62K

DomainStartEndE-ValueType
Pfam:F420_oxidored 80 173 1.1e-9 PFAM
low complexity region 261 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000221768
AA Change: I62K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000222480
AA Change: I62K

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Noxred1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01943:Noxred1 APN 12 87223181 missense probably benign 0.05
IGL01950:Noxred1 APN 12 87221416 missense probably damaging 1.00
IGL02381:Noxred1 APN 12 87225002 missense probably damaging 0.98
IGL03109:Noxred1 APN 12 87233438 missense probably damaging 1.00
PIT4504001:Noxred1 UTSW 12 87224879 missense possibly damaging 0.89
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0242:Noxred1 UTSW 12 87226979 missense probably benign 0.02
R0514:Noxred1 UTSW 12 87227064 missense probably benign 0.01
R0992:Noxred1 UTSW 12 87224226 missense probably benign 0.15
R1626:Noxred1 UTSW 12 87221255 makesense probably null
R2370:Noxred1 UTSW 12 87227046 missense probably benign 0.00
R3692:Noxred1 UTSW 12 87233466 missense probably benign 0.26
R4084:Noxred1 UTSW 12 87233484 missense possibly damaging 0.67
R5868:Noxred1 UTSW 12 87224202 missense possibly damaging 0.54
R6856:Noxred1 UTSW 12 87227036 missense probably benign 0.00
R6977:Noxred1 UTSW 12 87221317 missense probably null 0.00
R7388:Noxred1 UTSW 12 87227025 missense probably damaging 0.99
R7535:Noxred1 UTSW 12 87233432 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGGACTCTGGCCTCCTAGT -3'
(R):5'- ACTGCTGCAGAAAACTATAGCA -3'

Sequencing Primer
(F):5'- CCTAGTGGAGATCTGCAGGTTCTC -3'
(R):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
Posted On2019-06-07