Incidental Mutation 'PIT4402001:Aoah'
ID555542
Institutional Source Beutler Lab
Gene Symbol Aoah
Ensembl Gene ENSMUSG00000021322
Gene Nameacyloxyacyl hydrolase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4402001 (G1)
Quality Score200.009
Status Not validated
Chromosome13
Chromosomal Location20794113-21036617 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20794510 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 39 (S39R)
Ref Sequence ENSEMBL: ENSMUSP00000021757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021757] [ENSMUST00000221982]
Predicted Effect probably benign
Transcript: ENSMUST00000021757
AA Change: S39R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000021757
Gene: ENSMUSG00000021322
AA Change: S39R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
SapB 38 113 6.25e-15 SMART
Pfam:Lipase_GDSL 256 542 4.8e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221982
AA Change: S39R

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: This genes encodes an enzyme that catalyzes the hydrolysis of acyloxylacyl-linked fatty acyl chains from bacterial lipopolysaccharides. The encoded protein modulates host inflammatory response to gram-negative bacteria. The proprotein is further cleaved into a large and small chain that interact in a heterodimer. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous null mice have a reduced ability to deacylate bacterial lipopolysaccharides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Aoah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01561:Aoah APN 13 21005094 missense probably damaging 0.97
IGL01561:Aoah APN 13 20905735 splice site probably benign
IGL01717:Aoah APN 13 20999977 missense probably damaging 0.99
IGL01997:Aoah APN 13 20999938 missense probably benign 0.00
IGL02212:Aoah APN 13 21002901 missense probably benign 0.05
IGL02325:Aoah APN 13 20917125 missense probably damaging 0.97
IGL03028:Aoah APN 13 20816582 missense possibly damaging 0.62
IGL03304:Aoah APN 13 20915010 splice site probably benign
IGL03352:Aoah APN 13 21000043 missense probably benign 0.01
H8562:Aoah UTSW 13 20816524 missense probably damaging 1.00
R0255:Aoah UTSW 13 20979540 nonsense probably null
R0432:Aoah UTSW 13 20911198 splice site probably benign
R0501:Aoah UTSW 13 21005073 missense probably benign 0.16
R1036:Aoah UTSW 13 20840169 splice site probably benign
R1119:Aoah UTSW 13 20914938 splice site probably benign
R1203:Aoah UTSW 13 20816594 missense probably damaging 1.00
R1589:Aoah UTSW 13 21002948 missense probably damaging 0.99
R1662:Aoah UTSW 13 21000113 intron probably null
R1907:Aoah UTSW 13 20910094 missense probably damaging 1.00
R1959:Aoah UTSW 13 20794394 start codon destroyed probably null 0.89
R2145:Aoah UTSW 13 20840096 missense probably damaging 1.00
R2237:Aoah UTSW 13 20794311 start gained probably benign
R3438:Aoah UTSW 13 20917072 missense probably benign 0.00
R4226:Aoah UTSW 13 20979526 missense possibly damaging 0.50
R4868:Aoah UTSW 13 20914981 nonsense probably null
R5026:Aoah UTSW 13 20914959 missense probably damaging 1.00
R5139:Aoah UTSW 13 21023237 missense possibly damaging 0.61
R5624:Aoah UTSW 13 20995479 missense probably damaging 1.00
R5853:Aoah UTSW 13 20999902 missense probably benign 0.01
R6134:Aoah UTSW 13 20911123 missense probably damaging 1.00
R6459:Aoah UTSW 13 20999942 missense probably damaging 0.99
R7077:Aoah UTSW 13 20910106 missense probably damaging 1.00
R7103:Aoah UTSW 13 21023315 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACTACAGAGGGGCCAAGC -3'
(R):5'- GATACGAACGGAGCTGATCC -3'

Sequencing Primer
(F):5'- CAACATTGAGAAGTGGAGTGATCTTG -3'
(R):5'- GACAGGGTCTCAATATATAGCCCAG -3'
Posted On2019-06-07