Incidental Mutation 'PIT4402001:1700129C05Rik'
ID555543
Institutional Source Beutler Lab
Gene Symbol 1700129C05Rik
Ensembl Gene ENSMUSG00000021977
Gene NameRIKEN cDNA 1700129C05 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #PIT4402001 (G1)
Quality Score188.009
Status Not validated
Chromosome14
Chromosomal Location59133040-59142893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 59142635 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 71 (L71F)
Ref Sequence ENSEMBL: ENSMUSP00000022548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022548] [ENSMUST00000159858] [ENSMUST00000162271] [ENSMUST00000162674]
Predicted Effect probably damaging
Transcript: ENSMUST00000022548
AA Change: L71F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022548
Gene: ENSMUSG00000021977
AA Change: L71F

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159858
AA Change: L71F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000125361
Gene: ENSMUSG00000021977
AA Change: L71F

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162271
Predicted Effect probably benign
Transcript: ENSMUST00000162674
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pank1 A G 19: 34,840,966 Y233H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in 1700129C05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01475:1700129C05Rik APN 14 59142803 missense possibly damaging 0.85
IGL02960:1700129C05Rik APN 14 59142808 missense probably benign 0.11
R0226:1700129C05Rik UTSW 14 59142120 missense possibly damaging 0.92
R0324:1700129C05Rik UTSW 14 59142807 missense probably damaging 0.99
R0345:1700129C05Rik UTSW 14 59139630 missense possibly damaging 0.66
R2251:1700129C05Rik UTSW 14 59142612 missense probably damaging 0.99
R2252:1700129C05Rik UTSW 14 59142612 missense probably damaging 0.99
R2253:1700129C05Rik UTSW 14 59142612 missense probably damaging 0.99
R5574:1700129C05Rik UTSW 14 59142756 missense possibly damaging 0.59
X0063:1700129C05Rik UTSW 14 59140049 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ACCTCCTCTGGCTGAAAGTAG -3'
(R):5'- TAAGAGCTCTGCAGGGTCTG -3'

Sequencing Primer
(F):5'- GCTGAAAGTAGCTAGTTTCCAGATG -3'
(R):5'- TTGGGAAGTCTACGCAATCC -3'
Posted On2019-06-07