Incidental Mutation 'PIT4402001:Pank1'
ID555551
Institutional Source Beutler Lab
Gene Symbol Pank1
Ensembl Gene ENSMUSG00000033610
Gene Namepantothenate kinase 1
SynonymsPank1a, Pank1, 4632412I06Rik, Pank1b, 5430426F23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.160) question?
Stock #PIT4402001 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location34810894-34879455 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34840966 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 233 (Y233H)
Ref Sequence ENSEMBL: ENSMUSP00000043562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036584] [ENSMUST00000112460]
Predicted Effect probably damaging
Transcript: ENSMUST00000036584
AA Change: Y233H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043562
Gene: ENSMUSG00000033610
AA Change: Y233H

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
low complexity region 42 53 N/A INTRINSIC
low complexity region 135 147 N/A INTRINSIC
Pfam:Fumble 188 540 1.6e-121 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112460
AA Change: Y58H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108079
Gene: ENSMUSG00000033610
AA Change: Y58H

DomainStartEndE-ValueType
Pfam:Fumble 13 365 3.8e-122 PFAM
Coding Region Coverage
  • 1x: 92.8%
  • 3x: 90.3%
  • 10x: 83.2%
  • 20x: 68.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the pantothenate kinase family. Pantothenate kinases are key regulatory enzymes in the biosynthesis of coenzyme A (CoA). The encoded protein catalyzes the first and rate-limiting enzymatic reaction in CoA biosynthesis and is regulated by CoA through feedback inhibition. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. This gene and an intronic miRNA on the same strand are co-regulated by the tumor suppressor p53 (see PMID 20833636). [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutant has increased body weight, polyphagia, decreased serum triglyceride and glucose levels after fasting. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700129C05Rik T G 14: 59,142,635 L71F probably damaging Het
Adamts9 C T 6: 92,872,347 V1044I probably benign Het
Alcam T C 16: 52,295,134 Y207C probably damaging Het
Aldh4a1 C A 4: 139,642,191 S351* probably null Het
Aoah C A 13: 20,794,510 S39R probably benign Het
Arcn1 A T 9: 44,745,602 V421E possibly damaging Het
Ccdc18 A G 5: 108,158,619 E300G possibly damaging Het
Cdk2ap2 C A 19: 4,098,557 R126S probably damaging Het
Dcun1d4 A G 5: 73,510,933 I39V probably benign Het
Fam53b A T 7: 132,760,017 I94N probably damaging Het
Fam83g A G 11: 61,703,596 H652R probably damaging Het
Fanca A T 8: 123,313,064 M157K possibly damaging Het
Flt1 A T 5: 147,678,239 I299N probably damaging Het
Gm10800 CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA CAAGAAAACTGAAAATCA 2: 98,667,016 probably null Het
Gns A G 10: 121,376,706 Y191C probably damaging Het
Grin2a T C 16: 9,644,199 T690A possibly damaging Het
Gsk3b C T 16: 38,089,401 probably benign Het
Igsf10 A G 3: 59,325,579 V1911A probably benign Het
Igsf3 A G 3: 101,427,077 K157E probably benign Het
Inpp5a T C 7: 139,511,453 Y118H probably benign Het
Kmt2a A G 9: 44,841,062 V1413A unknown Het
Mettl9 T A 7: 121,057,217 V190E probably damaging Het
Mrps9 T C 1: 42,896,098 L188P probably benign Het
Myo9a A T 9: 59,870,436 R1158S possibly damaging Het
Nacad T G 11: 6,598,621 Q1371P probably benign Het
Ncoa1 T C 12: 4,294,987 M787V probably benign Het
Noxred1 A T 12: 87,227,081 I62K probably benign Het
Olfr1390 A G 11: 49,341,399 Y289C probably damaging Het
Olfr1532-ps1 T A 7: 106,915,087 D296E possibly damaging Het
Olfr350 A T 2: 36,850,304 H86L probably benign Het
Olfr646 A G 7: 104,106,450 Y57C probably damaging Het
Otud6b A G 4: 14,818,185 Y239H probably damaging Het
Pccb G T 9: 100,995,592 D286E probably benign Het
Plek A C 11: 16,990,121 L196R probably benign Het
Pou6f2 T C 13: 18,125,346 H576R Het
Rbm47 T A 5: 66,027,011 Y83F probably damaging Het
Rbm6 A T 9: 107,787,850 Y787N probably damaging Het
Slc8a2 C A 7: 16,134,494 A217E probably damaging Het
Suox G A 10: 128,671,295 A288V probably damaging Het
Tbccd1 T C 16: 22,822,123 I501M probably damaging Het
Tjp2 C A 19: 24,098,129 G1042* probably null Het
Tmtc2 T C 10: 105,413,407 Y155C probably damaging Het
Usp7 T C 16: 8,698,495 N600S probably benign Het
Zer1 T C 2: 30,101,120 I699V probably damaging Het
Zfp142 A G 1: 74,579,528 F227S probably damaging Het
Other mutations in Pank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:Pank1 APN 19 34840852 missense probably damaging 1.00
IGL02266:Pank1 APN 19 34813686 splice site probably benign
IGL02814:Pank1 APN 19 34840855 missense probably damaging 1.00
IGL03029:Pank1 APN 19 34821135 missense probably damaging 0.96
R0388:Pank1 UTSW 19 34821706 splice site probably benign
R1254:Pank1 UTSW 19 34840860 missense probably benign 0.16
R1820:Pank1 UTSW 19 34877684 critical splice donor site probably null
R1928:Pank1 UTSW 19 34878881 missense probably benign
R2117:Pank1 UTSW 19 34841086 missense probably damaging 1.00
R2141:Pank1 UTSW 19 34878980 missense possibly damaging 0.91
R2147:Pank1 UTSW 19 34827354 missense probably benign 0.12
R2226:Pank1 UTSW 19 34827363 missense probably damaging 1.00
R4363:Pank1 UTSW 19 34827132 missense probably damaging 1.00
R4376:Pank1 UTSW 19 34877704 missense probably benign
R5081:Pank1 UTSW 19 34878916 missense probably benign
R5172:Pank1 UTSW 19 34840802 nonsense probably null
R6706:Pank1 UTSW 19 34812386 missense probably damaging 1.00
R6811:Pank1 UTSW 19 34841022 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- GTCCTCCTCAAACTTGAAAGCC -3'
(R):5'- AATTTAGTGCGGGATGCCTG -3'

Sequencing Primer
(F):5'- TTGAAAGCCCCACCTCCCG -3'
(R):5'- GGATGCCTGCTTTTCGTATGTCAC -3'
Posted On2019-06-07