Incidental Mutation 'PIT4418001:Sun1'
ID555577
Institutional Source Beutler Lab
Gene Symbol Sun1
Ensembl Gene ENSMUSG00000036817
Gene NameSad1 and UNC84 domain containing 1
SynonymsUnc84a, 5730434D03Rik, 4632417G13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4418001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location139200637-139249840 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 139226588 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 155 (D155E)
Ref Sequence ENSEMBL: ENSMUSP00000056655 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058716] [ENSMUST00000078690] [ENSMUST00000100517] [ENSMUST00000110882] [ENSMUST00000110883] [ENSMUST00000110884] [ENSMUST00000127045] [ENSMUST00000129079] [ENSMUST00000135720] [ENSMUST00000143562] [ENSMUST00000146715] [ENSMUST00000148772]
Predicted Effect probably damaging
Transcript: ENSMUST00000058716
AA Change: D155E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056655
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 334 450 2e-3 SMART
low complexity region 466 475 N/A INTRINSIC
coiled coil region 492 527 N/A INTRINSIC
SCOP:d1eq1a_ 572 689 3e-3 SMART
Pfam:Sad1_UNC 777 911 2.2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078690
AA Change: D155E

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000077756
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 270 386 2e-3 SMART
low complexity region 402 411 N/A INTRINSIC
coiled coil region 428 463 N/A INTRINSIC
SCOP:d1eq1a_ 508 625 2e-3 SMART
Pfam:Sad1_UNC 713 847 1.9e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100517
AA Change: D155E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098086
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110882
AA Change: D155E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106506
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
low complexity region 263 271 N/A INTRINSIC
low complexity region 310 319 N/A INTRINSIC
coiled coil region 336 371 N/A INTRINSIC
SCOP:d1eq1a_ 416 533 4e-3 SMART
Pfam:Sad1_UNC 621 755 7.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110883
AA Change: D155E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106507
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
SCOP:d1qovm1 233 327 4e-3 SMART
low complexity region 343 352 N/A INTRINSIC
coiled coil region 369 404 N/A INTRINSIC
SCOP:d1eq1a_ 449 566 3e-3 SMART
Pfam:Sad1_UNC 654 788 1.7e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110884
AA Change: D155E

PolyPhen 2 Score 0.675 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000106508
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 108 127 N/A INTRINSIC
low complexity region 152 162 N/A INTRINSIC
ZnF_C2H2 183 205 5.2e0 SMART
Pfam:MRP 274 381 1.8e-8 PFAM
low complexity region 382 390 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
coiled coil region 455 490 N/A INTRINSIC
SCOP:d1eq1a_ 535 652 4e-3 SMART
Pfam:Sad1_UNC 740 874 2e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127045
SMART Domains Protein: ENSMUSP00000123211
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129079
SMART Domains Protein: ENSMUSP00000119582
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 32 44 N/A INTRINSIC
Pfam:MRP 71 131 8.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000135720
AA Change: D61E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122785
Gene: ENSMUSG00000036817
AA Change: D61E

DomainStartEndE-ValueType
low complexity region 14 33 N/A INTRINSIC
ZnF_C2H2 98 120 5.2e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135926
SMART Domains Protein: ENSMUSP00000114488
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
ZnF_C2H2 11 33 5.2e0 SMART
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 149 171 N/A INTRINSIC
low complexity region 202 211 N/A INTRINSIC
coiled coil region 227 255 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000143562
AA Change: D155E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116364
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 158 7e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000146715
AA Change: D155E

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117679
Gene: ENSMUSG00000036817
AA Change: D155E

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
Pfam:MRP 62 160 4.8e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148772
SMART Domains Protein: ENSMUSP00000114869
Gene: ENSMUSG00000036817

DomainStartEndE-ValueType
low complexity region 64 76 N/A INTRINSIC
Pfam:MRP 103 176 1.9e-24 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the unc-84 homolog family and encodes a nuclear nuclear envelope protein with an Unc84 (SUN) domain. The protein is involved in nuclear anchorage and migration. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit sterility due to arrested meiosis, hearing loss associated with outer hair cell degeneration, abnormal cerebellum development, ataxia, impaired motor coordination, and abnormal Purkinje cell migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 T C 6: 88,839,648 Y100C possibly damaging Het
Adamtsl1 T C 4: 86,243,724 Y365H probably damaging Het
Atad2b A T 12: 5,024,587 I1049F probably benign Het
Atg9b A T 5: 24,385,515 S859T possibly damaging Het
Banp G A 8: 122,005,626 A380T probably damaging Het
Brinp3 C T 1: 146,901,423 T536I probably damaging Het
Cacna1c T C 6: 118,654,423 E1155G Het
Capn12 T C 7: 28,886,536 S270P probably benign Het
Cbs A T 17: 31,615,521 I498N possibly damaging Het
Ccdc129 T G 6: 55,968,345 S684A probably damaging Het
Cep68 T C 11: 20,239,731 K427R probably benign Het
Cobl G A 11: 12,256,240 T545I possibly damaging Het
Cr2 T A 1: 195,157,452 M556L probably benign Het
Crebbp A G 16: 4,114,825 S1068P probably benign Het
D2hgdh C T 1: 93,838,868 H385Y possibly damaging Het
Dennd1b T C 1: 139,081,261 L159P Het
Dnajb4 A T 3: 152,193,497 F31I possibly damaging Het
Dnajc16 A G 4: 141,770,949 F369S probably damaging Het
Dtl A T 1: 191,541,317 L493H possibly damaging Het
Efcab5 T A 11: 77,132,051 Q612L possibly damaging Het
Efr3b A T 12: 3,980,490 L407Q possibly damaging Het
Ehbp1 T A 11: 22,053,494 Q1085L probably damaging Het
Ell T C 8: 70,581,681 V199A probably damaging Het
Elmod2 G T 8: 83,321,542 T97K probably benign Het
Epn3 T C 11: 94,496,130 E138G probably damaging Het
Esf1 A T 2: 140,159,777 F383L probably benign Het
Fam193a A T 5: 34,440,535 T559S probably damaging Het
Galr2 T C 11: 116,283,258 V238A probably benign Het
Gm3476 T C 14: 6,118,411 I237M probably benign Het
Gm5160 A T 18: 14,425,282 I139F probably damaging Het
Gpr15 T C 16: 58,717,950 T259A probably benign Het
Iffo1 A G 6: 125,149,783 K293E possibly damaging Het
Ikbip T A 10: 91,096,533 H346Q probably benign Het
Il4ra G A 7: 125,576,338 G573S probably benign Het
Ing2 A T 8: 47,669,090 M141K probably benign Het
Itga6 T C 2: 71,834,070 S517P probably benign Het
Kcnab1 A G 3: 65,358,320 E295G probably benign Het
Klhl21 A C 4: 152,015,378 Y515S possibly damaging Het
Lcn9 A T 2: 25,824,541 Y139F probably damaging Het
Mcemp1 G T 8: 3,667,052 L64F probably null Het
Mos T C 4: 3,870,814 D334G possibly damaging Het
Myo9b T G 8: 71,322,947 F338V probably damaging Het
Nefl G A 14: 68,086,530 V406M probably damaging Het
Nfam1 C A 15: 83,001,488 R181L probably damaging Het
Ntn5 A G 7: 45,686,501 R119G probably damaging Het
Olfr1145 G T 2: 87,810,594 C258F probably damaging Het
Olfr1453 A T 19: 13,027,731 Y199* probably null Het
Olfr19 T C 16: 16,673,855 N42S probably damaging Het
Plch2 A T 4: 154,989,503 V914E probably damaging Het
Ppp1r12c T C 7: 4,501,267 Q111R probably null Het
Ptchd3 T A 11: 121,841,740 Y485* probably null Het
Ptchd4 T A 17: 42,503,089 I627N probably damaging Het
Retnlb T C 16: 48,817,268 V19A probably benign Het
Rimbp2 T A 5: 128,780,361 T809S probably benign Het
Sema6c T A 3: 95,170,090 D404E possibly damaging Het
Slc22a16 C T 10: 40,603,825 A631V unknown Het
Snai3 A T 8: 122,456,334 H157Q probably benign Het
Snx15 T C 19: 6,123,931 Y52C probably damaging Het
Strbp T C 2: 37,645,492 E68G probably benign Het
Susd2 T C 10: 75,638,349 D627G probably benign Het
Tas2r108 T A 6: 40,493,680 I30K probably damaging Het
Tmc2 T C 2: 130,248,651 V639A probably damaging Het
Trmt1 T C 8: 84,697,670 Y445H probably damaging Het
Ttn A T 2: 76,767,210 N19786K probably damaging Het
Vmn1r79 T G 7: 12,176,839 V216G probably damaging Het
Wdr64 C A 1: 175,743,594 Y331* probably null Het
Zfyve28 A T 5: 34,233,377 V180E probably damaging Het
Zic4 C T 9: 91,379,394 T234I possibly damaging Het
Other mutations in Sun1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Sun1 APN 5 139234685 critical splice acceptor site probably null
IGL01364:Sun1 APN 5 139234741 missense probably damaging 1.00
IGL02142:Sun1 APN 5 139231163 missense possibly damaging 0.95
IGL02251:Sun1 APN 5 139241431 missense probably damaging 1.00
IGL02939:Sun1 APN 5 139235488 splice site probably benign
IGL03253:Sun1 APN 5 139223586 splice site probably benign
IGL03370:Sun1 APN 5 139231131 missense probably damaging 0.96
R0124:Sun1 UTSW 5 139246679 unclassified probably benign
R0145:Sun1 UTSW 5 139241411 missense probably damaging 0.98
R0376:Sun1 UTSW 5 139226699 unclassified probably benign
R0512:Sun1 UTSW 5 139234847 splice site probably benign
R0729:Sun1 UTSW 5 139237864 unclassified probably benign
R0733:Sun1 UTSW 5 139231163 missense possibly damaging 0.63
R1188:Sun1 UTSW 5 139238856 missense probably damaging 0.98
R1724:Sun1 UTSW 5 139235725 missense probably benign
R1733:Sun1 UTSW 5 139230789 missense possibly damaging 0.82
R1913:Sun1 UTSW 5 139235732 critical splice donor site probably null
R2033:Sun1 UTSW 5 139225438 missense probably damaging 1.00
R2200:Sun1 UTSW 5 139231219 missense probably benign 0.11
R3084:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3085:Sun1 UTSW 5 139235601 missense probably benign 0.41
R3771:Sun1 UTSW 5 139238820 unclassified probably benign
R3772:Sun1 UTSW 5 139238820 unclassified probably benign
R3804:Sun1 UTSW 5 139225362 nonsense probably null
R4300:Sun1 UTSW 5 139227594 unclassified probably benign
R4428:Sun1 UTSW 5 139234475 intron probably benign
R4993:Sun1 UTSW 5 139225333 missense possibly damaging 0.84
R5075:Sun1 UTSW 5 139226891 splice site probably null
R5363:Sun1 UTSW 5 139234743 missense probably damaging 1.00
R5826:Sun1 UTSW 5 139245416 missense probably damaging 1.00
R6753:Sun1 UTSW 5 139215259 splice site probably null
R7218:Sun1 UTSW 5 139226687 missense unknown
R7320:Sun1 UTSW 5 139248484 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATAAAGCTAGCTAGATCTTCCCC -3'
(R):5'- GTGTATCCATTGCTGCTCGC -3'

Sequencing Primer
(F):5'- CCTTGTGGGCCAGAATGTGC -3'
(R):5'- GCCACCTCTGCTGCCAG -3'
Posted On2019-06-07