Incidental Mutation 'PIT4468001:Mib1'
ID555671
Institutional Source Beutler Lab
Gene Symbol Mib1
Ensembl Gene ENSMUSG00000024294
Gene Namemindbomb E3 ubiquitin protein ligase 1
SynonymsMib, mind bomb-1, skeletrophin, E430019M12Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4468001 (G1)
Quality Score133.008
Status Not validated
Chromosome18
Chromosomal Location10725548-10818704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10798463 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 775 (S775P)
Ref Sequence ENSEMBL: ENSMUSP00000054428 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052838] [ENSMUST00000165555]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052838
AA Change: S775P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000054428
Gene: ENSMUSG00000024294
AA Change: S775P

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 72 5.6e-21 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 219 4.9e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000114289
Gene: ENSMUSG00000024294
AA Change: S409P

DomainStartEndE-ValueType
ANK 65 95 1.63e3 SMART
ANK 98 127 2.1e-3 SMART
ANK 131 160 2.47e2 SMART
ANK 164 193 6.02e-4 SMART
ANK 197 226 1.14e-4 SMART
ANK 230 261 6.26e-2 SMART
ANK 266 296 1.24e-5 SMART
ANK 300 329 9.27e-5 SMART
ANK 333 364 1.04e2 SMART
RING 454 488 1.8e-1 SMART
RING 501 535 1.9e-1 SMART
RING 598 630 4.58e-4 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000122879
Gene: ENSMUSG00000024294
AA Change: S33P

DomainStartEndE-ValueType
Blast:ANK 2 27 5e-6 BLAST
RING 78 112 1.8e-1 SMART
RING 125 159 1.9e-1 SMART
RING 222 254 4.58e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165555
AA Change: S775P

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131712
Gene: ENSMUSG00000024294
AA Change: S775P

DomainStartEndE-ValueType
Pfam:MIB_HERC2 15 74 5.7e-25 PFAM
ZnF_ZZ 79 124 1.01e-10 SMART
Pfam:MIB_HERC2 154 221 5.5e-31 PFAM
ANK 430 460 1.63e3 SMART
ANK 463 492 2.1e-3 SMART
ANK 496 525 2.47e2 SMART
ANK 529 558 6.02e-4 SMART
ANK 562 591 1.14e-4 SMART
ANK 595 626 6.26e-2 SMART
ANK 631 661 1.24e-5 SMART
ANK 665 694 9.27e-5 SMART
ANK 698 729 1.04e2 SMART
RING 819 853 1.8e-1 SMART
RING 866 900 1.9e-1 SMART
RING 963 995 4.58e-4 SMART
Coding Region Coverage
  • 1x: 93.0%
  • 3x: 90.7%
  • 10x: 85.2%
  • 20x: 72.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple ankyrin repeats and RING finger domains that functions as an E3 ubiquitin ligase. The encoded protein positively regulates Notch signaling by ubiquitinating the Notch receptors, thereby facilitating their endocytosis. This protein may also promote the ubiquitination and degradation of death-associated protein kinase 1 (DAPK1). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, failure of heart looping, impaired angiogenesis and arterial specification, premature neuronal precursor differentiation, posterior truncation, and abnormal somitogenesis with loss ofposterior markers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610042L04Rik C T 14: 4,348,940 L34F probably damaging Het
Alms1 T C 6: 85,624,719 probably null Het
Arhgap15 C A 2: 44,243,131 Q350K probably damaging Het
Bbs1 T A 19: 4,906,162 H35L probably benign Het
Cep85 T C 4: 134,148,697 N468S probably damaging Het
Chd8 A C 14: 52,207,996 D1709E probably benign Het
Chd8 T C 14: 52,217,881 I1050V possibly damaging Het
Clec9a G A 6: 129,419,634 probably null Het
Cyp2c70 T A 19: 40,165,362 D261V probably damaging Het
Deup1 T C 9: 15,564,005 N420D possibly damaging Het
Dpys T A 15: 39,857,205 D53V probably damaging Het
Edem1 A G 6: 108,844,867 E295G probably damaging Het
Farp2 G T 1: 93,528,777 E61* probably null Het
Fat3 T G 9: 15,996,351 D2785A probably benign Het
Fbxo30 T A 10: 11,290,956 M474K possibly damaging Het
Gm13090 C A 4: 151,091,082 P93Q unknown Het
Gm21976 A T 13: 98,307,027 R229* probably null Het
Gpr108 A T 17: 57,247,563 L25Q probably null Het
Hdac9 C A 12: 34,095,934 V920F unknown Het
Ighv13-2 T C 12: 114,357,973 S49G probably benign Het
Krt6a T C 15: 101,693,917 Y111C probably damaging Het
Mki67 A G 7: 135,699,147 I1386T probably benign Het
Mroh2b A G 15: 4,912,812 E352G probably damaging Het
Nfya A G 17: 48,395,777 M61T unknown Het
Ntn4 A G 10: 93,644,725 T104A probably damaging Het
Numb G A 12: 83,808,147 T135I probably damaging Het
Olfr1030 A T 2: 85,984,448 T203S probably benign Het
Olfr1271 C A 2: 90,266,220 C70F probably benign Het
Olfr599 A C 7: 103,338,600 E182A probably damaging Het
Parpbp A C 10: 88,144,073 L7R probably benign Het
Pcdhb8 T C 18: 37,356,633 Y455H probably damaging Het
Pcdhga10 T A 18: 37,747,883 D232E probably damaging Het
Pcdhga9 T A 18: 37,739,474 C785* probably null Het
Pkd1l3 A G 8: 109,664,499 Y1913C possibly damaging Het
Pld4 T G 12: 112,767,822 L374R probably damaging Het
Ppp1r13b A T 12: 111,838,702 I350N probably benign Het
Rc3h2 C A 2: 37,399,639 G387V probably damaging Het
Rfwd3 T C 8: 111,282,720 H408R probably benign Het
Rpl3l A G 17: 24,735,483 T173A probably benign Het
Sdad1 T C 5: 92,291,918 D416G probably damaging Het
Srp72 C A 5: 76,994,206 T430K probably benign Het
Steap1 C A 5: 5,736,642 G265V probably damaging Het
Sulf2 A T 2: 166,080,800 I670N probably benign Het
Tcf7l2 A T 19: 55,742,388 D16V probably damaging Het
Tmem100 T A 11: 90,035,361 S5T probably benign Het
Tnc C A 4: 63,964,667 D1906Y probably damaging Het
Trak1 T C 9: 121,453,332 S436P probably benign Het
Ttyh1 T C 7: 4,119,772 Y40H possibly damaging Het
Ubxn8 T A 8: 33,621,541 S275C probably benign Het
Umodl1 A G 17: 30,959,278 Y76C probably damaging Het
Upk3b C T 5: 136,043,007 T222M probably benign Het
Usp42 T A 5: 143,714,644 K1208M probably damaging Het
Vmn2r25 A T 6: 123,839,598 D341E probably benign Het
Vmn2r83 T G 10: 79,478,050 L164R probably damaging Het
Vwa8 G T 14: 79,183,061 R1734L probably damaging Het
Zfand2b G T 1: 75,169,832 R117L probably benign Het
Other mutations in Mib1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Mib1 APN 18 10798490 missense probably benign 0.02
IGL02300:Mib1 APN 18 10741016 missense probably damaging 1.00
IGL02701:Mib1 APN 18 10747357 missense probably damaging 0.98
IGL02731:Mib1 APN 18 10800115 missense possibly damaging 0.81
IGL03002:Mib1 APN 18 10798356 missense possibly damaging 0.87
IGL03083:Mib1 APN 18 10752029 critical splice donor site probably null
PIT4466001:Mib1 UTSW 18 10775541 missense probably benign 0.01
R0496:Mib1 UTSW 18 10804773 missense probably benign
R1015:Mib1 UTSW 18 10726409 missense probably damaging 1.00
R1237:Mib1 UTSW 18 10768149 missense probably damaging 1.00
R1557:Mib1 UTSW 18 10798474 missense probably damaging 1.00
R1918:Mib1 UTSW 18 10740972 splice site probably null
R1952:Mib1 UTSW 18 10812077 missense possibly damaging 0.94
R1982:Mib1 UTSW 18 10812064 missense probably damaging 1.00
R2009:Mib1 UTSW 18 10812118 missense probably damaging 1.00
R2372:Mib1 UTSW 18 10812045 missense probably damaging 1.00
R2422:Mib1 UTSW 18 10751906 missense probably damaging 1.00
R2922:Mib1 UTSW 18 10760831 nonsense probably null
R2923:Mib1 UTSW 18 10760831 nonsense probably null
R2938:Mib1 UTSW 18 10752033 splice site probably benign
R3814:Mib1 UTSW 18 10763281 missense probably benign 0.09
R3858:Mib1 UTSW 18 10798409 missense possibly damaging 0.56
R4356:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4357:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4358:Mib1 UTSW 18 10751844 missense probably benign 0.03
R4406:Mib1 UTSW 18 10763289 missense probably damaging 1.00
R4497:Mib1 UTSW 18 10811985 missense possibly damaging 0.75
R4593:Mib1 UTSW 18 10768191 missense possibly damaging 0.89
R4623:Mib1 UTSW 18 10808086 missense probably benign 0.02
R5068:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5069:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5070:Mib1 UTSW 18 10793002 missense probably damaging 0.99
R5258:Mib1 UTSW 18 10795856 splice site probably null
R5322:Mib1 UTSW 18 10792975 missense probably damaging 1.00
R5589:Mib1 UTSW 18 10794488 missense probably benign 0.00
R5622:Mib1 UTSW 18 10794503 missense possibly damaging 0.90
R6401:Mib1 UTSW 18 10795802 missense probably benign
R6928:Mib1 UTSW 18 10802282 missense probably benign 0.02
R7242:Mib1 UTSW 18 10741011 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATACACACGGCAGATTTCTG -3'
(R):5'- CACATGACATAGAGGAAAGGTTTC -3'

Sequencing Primer
(F):5'- CATACACACGGCAGATTTCTGTAAGG -3'
(R):5'- GGCAACACTTTAACACTTTACAGTTC -3'
Posted On2019-06-07