Incidental Mutation 'PIT4449001:Nrxn1'
ID555758
Institutional Source Beutler Lab
Gene Symbol Nrxn1
Ensembl Gene ENSMUSG00000024109
Gene Nameneurexin I
Synonymsneurexin I beta, alpha-latrotoxin receptor (calcium-dependent), A230068P09Rik, neurexin I alpha, neurexin I alpha, neurexin I beta, 1700062G21Rik, 9330127H16Rik, neurexin I alpha, neurexin I beta
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4449001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location90033631-91093071 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 90597579 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 809 (W809R)
Ref Sequence ENSEMBL: ENSMUSP00000125407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054059] [ENSMUST00000072671] [ENSMUST00000160800] [ENSMUST00000160844] [ENSMUST00000161402] [ENSMUST00000174331] [ENSMUST00000177342]
Predicted Effect probably damaging
Transcript: ENSMUST00000054059
AA Change: W801R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057294
Gene: ENSMUSG00000024109
AA Change: W801R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1426 1441 N/A INTRINSIC
4.1m 1444 1462 1.19e-6 SMART
low complexity region 1481 1493 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000072671
AA Change: W801R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072458
Gene: ENSMUSG00000024109
AA Change: W801R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 438 2.3e-36 SMART
LamG 492 644 2.74e-43 SMART
EGF 671 705 1.58e-3 SMART
LamG 730 869 7.27e-25 SMART
LamG 917 1053 8.46e-35 SMART
EGF 1078 1112 1.87e1 SMART
LamG 1140 1297 7.74e-20 SMART
low complexity region 1324 1355 N/A INTRINSIC
low complexity region 1423 1438 N/A INTRINSIC
4.1m 1441 1459 1.19e-6 SMART
low complexity region 1478 1490 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160800
AA Change: W797R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124561
Gene: ENSMUSG00000024109
AA Change: W797R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 300 434 2.3e-36 SMART
LamG 488 640 2.74e-43 SMART
EGF 667 701 1.58e-3 SMART
LamG 726 865 7.27e-25 SMART
LamG 913 1049 8.46e-35 SMART
EGF 1074 1108 1.87e1 SMART
LamG 1136 1293 7.74e-20 SMART
low complexity region 1320 1351 N/A INTRINSIC
low complexity region 1422 1437 N/A INTRINSIC
4.1m 1440 1458 1.19e-6 SMART
low complexity region 1477 1489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160844
AA Change: W809R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125407
Gene: ENSMUSG00000024109
AA Change: W809R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1305 7.74e-20 SMART
low complexity region 1332 1363 N/A INTRINSIC
low complexity region 1434 1449 N/A INTRINSIC
4.1m 1452 1470 1.19e-6 SMART
low complexity region 1489 1501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161402
AA Change: W816R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124116
Gene: ENSMUSG00000024109
AA Change: W816R

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 453 3.46e-31 SMART
LamG 507 659 2.74e-43 SMART
EGF 686 720 1.58e-3 SMART
LamG 745 884 7.27e-25 SMART
LamG 932 1068 8.46e-35 SMART
EGF 1093 1127 1.87e1 SMART
LamG 1155 1312 7.74e-20 SMART
low complexity region 1339 1370 N/A INTRINSIC
low complexity region 1441 1456 N/A INTRINSIC
4.1m 1459 1477 1.19e-6 SMART
low complexity region 1496 1508 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174331
AA Change: W809R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133491
Gene: ENSMUSG00000024109
AA Change: W809R

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LamG 50 192 2.29e-31 SMART
EGF 216 256 4.26e0 SMART
LamG 304 446 1.24e-32 SMART
LamG 500 652 2.74e-43 SMART
EGF 679 713 1.58e-3 SMART
LamG 738 877 7.27e-25 SMART
LamG 925 1061 8.46e-35 SMART
EGF 1086 1120 1.87e1 SMART
LamG 1148 1275 3.29e-23 SMART
low complexity region 1302 1333 N/A INTRINSIC
low complexity region 1404 1419 N/A INTRINSIC
4.1m 1422 1440 1.19e-6 SMART
low complexity region 1459 1471 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000177342
AA Change: W199R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135301
Gene: ENSMUSG00000024109
AA Change: W199R

DomainStartEndE-ValueType
Pfam:Laminin_G_2 1 51 4.8e-5 PFAM
EGF 78 112 7.6e-6 SMART
LamG 137 267 5.3e-29 SMART
SCOP:d1dyka1 273 327 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197224
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a single-pass type I membrane protein that belongs to the neurexin family. Neurexins are synaptic transmembrane receptors that bind endogenous ligands that include neuroligins, dystroglycan, and neurexophilins. Neurexin complexes are required for efficient neurotransmission and are involved in synaptogenesis. In vertebrates, alternate promoter usage results in multiple isoform classes, of which the alpha and beta classes are the best characterized. In humans, allelic variants in this gene are associated with Pitt-Hopkins-like syndrome-2, while deletions have been associated with autism and schizophrenia. Mouse knockouts display decreased spontaneous and evoked vesicle release resulting in impaired synaptic transmission. In addition, knockout mice show altered social approach, reduced social investigation, reduced locomotor activity, and in males, increased aggression. Alternative splicing and promoter usage result in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced Ca(2+)-dependent binding of alpha-latrotoxin to brain membranes. Isolated synaptosomes display only a small reduction in alpha-latrotoxin -triggered glutamate release in the absence of Ca(2+) but show a major decrease in the presence of Ca(2+). [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asf1b A G 8: 83,967,982 N125S probably benign Het
BC048671 T A 6: 90,305,163 L101I probably damaging Het
Camta1 A G 4: 151,131,586 L959P probably benign Het
Cfh C A 1: 140,112,565 V598F probably damaging Het
Cyp2j7 G T 4: 96,215,338 T320K probably damaging Het
Ddr1 A G 17: 35,687,249 I468T possibly damaging Het
Dhx15 A G 5: 52,160,958 V510A probably damaging Het
Dpp4 T A 2: 62,356,644 K507N probably benign Het
Evpl G A 11: 116,233,399 T198M possibly damaging Het
Gabbr1 G A 17: 37,056,350 V373I probably damaging Het
Gak A T 5: 108,580,925 S1049T probably benign Het
Gipr C T 7: 19,160,618 R253H probably benign Het
Gm3685 T A 14: 7,043,960 M73L probably benign Het
Gm5168 C T X: 26,039,540 R129Q probably null Het
Kcnh1 T A 1: 192,418,684 V555D probably damaging Het
Kif26b T C 1: 178,918,086 S1916P probably damaging Het
Lingo4 T C 3: 94,401,932 V59A probably benign Het
Maats1 T C 16: 38,328,358 E236G probably damaging Het
Mroh8 T A 2: 157,225,534 Q635L probably damaging Het
Msh6 T A 17: 87,986,188 D790E probably damaging Het
Olfr201 C A 16: 59,269,130 C179F probably damaging Het
Polr3d T C 14: 70,439,463 H397R probably benign Het
Pwp2 G A 10: 78,178,470 T432I probably benign Het
Rad21 G C 15: 51,973,243 F177L probably benign Het
Rnf182 G A 13: 43,668,677 V235I probably benign Het
Scn11a C T 9: 119,769,948 C1172Y probably damaging Het
Sh2b3 A G 5: 121,828,679 L124P possibly damaging Het
Six2 T C 17: 85,685,478 N199S probably benign Het
Slc5a3 A G 16: 92,077,814 D253G probably benign Het
Synm A G 7: 67,735,277 M879T probably benign Het
Tasp1 A G 2: 139,910,535 I328T possibly damaging Het
Tbrg4 T C 11: 6,619,689 Q309R probably damaging Het
Tcrg-C3 A T 13: 19,263,362 R162* probably null Het
Tmtc2 A G 10: 105,303,604 L687P probably damaging Het
Tufm T C 7: 126,487,449 M1T probably null Het
Vmn2r116 A C 17: 23,388,947 L496F probably benign Het
Vmn2r75 C T 7: 86,165,583 C234Y probably damaging Het
Wars2 G T 3: 99,205,279 V162L possibly damaging Het
Zc3h11a A T 1: 133,624,611 V586D probably benign Het
Zdhhc5 A T 2: 84,690,227 N535K probably damaging Het
Zfp52 T C 17: 21,557,216 Y38H probably damaging Het
Zfp729b T C 13: 67,591,423 M908V probably benign Het
Zfp772 T C 7: 7,204,351 I114V probably benign Het
Other mutations in Nrxn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Nrxn1 APN 17 90059474 critical splice donor site probably null
IGL01644:Nrxn1 APN 17 90620873 missense possibly damaging 0.94
IGL01820:Nrxn1 APN 17 90643103 missense probably damaging 0.98
IGL01902:Nrxn1 APN 17 91088491 unclassified probably null
IGL02079:Nrxn1 APN 17 90643083 missense probably damaging 0.99
IGL02089:Nrxn1 APN 17 91088401 missense probably benign 0.01
IGL02133:Nrxn1 APN 17 90643243 missense probably damaging 1.00
IGL02179:Nrxn1 APN 17 90630083 missense probably damaging 0.99
IGL02199:Nrxn1 APN 17 90037258 missense probably damaging 1.00
IGL02262:Nrxn1 APN 17 90704208 missense probably damaging 1.00
IGL02941:Nrxn1 APN 17 90208383 missense probably damaging 1.00
PIT4791001:Nrxn1 UTSW 17 90455503 intron probably benign
R0123:Nrxn1 UTSW 17 90995487 splice site probably null
R0212:Nrxn1 UTSW 17 90362758 unclassified probably benign
R0277:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0323:Nrxn1 UTSW 17 90700742 critical splice donor site probably null
R0384:Nrxn1 UTSW 17 90208347 missense probably damaging 1.00
R0395:Nrxn1 UTSW 17 91088314 missense possibly damaging 0.90
R0606:Nrxn1 UTSW 17 90565373 missense probably damaging 1.00
R0616:Nrxn1 UTSW 17 90362857 missense probably damaging 1.00
R0624:Nrxn1 UTSW 17 91088689 missense unknown
R0633:Nrxn1 UTSW 17 90704181 missense probably damaging 1.00
R0927:Nrxn1 UTSW 17 90037330 missense probably damaging 1.00
R1035:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R1221:Nrxn1 UTSW 17 90643294 missense probably damaging 0.97
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1403:Nrxn1 UTSW 17 90643053 missense probably benign 0.11
R1691:Nrxn1 UTSW 17 90162289 missense probably damaging 0.98
R1703:Nrxn1 UTSW 17 90208417 missense probably damaging 1.00
R1709:Nrxn1 UTSW 17 90037187 missense probably damaging 1.00
R1721:Nrxn1 UTSW 17 90162404 missense probably damaging 1.00
R1792:Nrxn1 UTSW 17 90588824 missense probably damaging 0.96
R1980:Nrxn1 UTSW 17 91088318 missense probably benign 0.01
R2116:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2117:Nrxn1 UTSW 17 90704277 missense probably damaging 1.00
R2162:Nrxn1 UTSW 17 90162431 missense probably damaging 1.00
R3119:Nrxn1 UTSW 17 90597519 nonsense probably null
R3409:Nrxn1 UTSW 17 90208367 missense probably damaging 1.00
R3683:Nrxn1 UTSW 17 90623452 missense probably damaging 1.00
R3885:Nrxn1 UTSW 17 90623471 missense probably damaging 1.00
R3939:Nrxn1 UTSW 17 90208421 missense probably damaging 1.00
R4475:Nrxn1 UTSW 17 90701982 missense probably damaging 0.98
R4640:Nrxn1 UTSW 17 90560768 missense probably damaging 1.00
R4678:Nrxn1 UTSW 17 90623422 missense probably damaging 1.00
R4690:Nrxn1 UTSW 17 90037081 missense probably damaging 1.00
R4790:Nrxn1 UTSW 17 90455049 missense possibly damaging 0.86
R4877:Nrxn1 UTSW 17 91088177 missense probably benign 0.33
R4989:Nrxn1 UTSW 17 90620846 intron probably benign
R5204:Nrxn1 UTSW 17 90162364 missense probably damaging 1.00
R5205:Nrxn1 UTSW 17 90163874 missense probably damaging 0.96
R5239:Nrxn1 UTSW 17 90704109 missense probably damaging 1.00
R5250:Nrxn1 UTSW 17 90535441 intron probably benign
R5473:Nrxn1 UTSW 17 90590092 missense probably damaging 1.00
R5629:Nrxn1 UTSW 17 90590032 missense possibly damaging 0.75
R5743:Nrxn1 UTSW 17 90643224 missense probably damaging 1.00
R5910:Nrxn1 UTSW 17 90704318 nonsense probably null
R5961:Nrxn1 UTSW 17 90454943 missense probably damaging 0.99
R5979:Nrxn1 UTSW 17 91088203 missense possibly damaging 0.54
R5992:Nrxn1 UTSW 17 90623507 missense probably benign 0.01
R6024:Nrxn1 UTSW 17 90590098 missense possibly damaging 0.88
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6031:Nrxn1 UTSW 17 90588790 missense probably damaging 1.00
R6185:Nrxn1 UTSW 17 90037136 missense probably damaging 1.00
R6220:Nrxn1 UTSW 17 91088476 missense probably benign 0.14
R6306:Nrxn1 UTSW 17 90565446 missense possibly damaging 0.55
R6621:Nrxn1 UTSW 17 90162182 missense probably damaging 1.00
R6669:Nrxn1 UTSW 17 90059563 missense probably damaging 0.98
R6770:Nrxn1 UTSW 17 90037179 missense probably damaging 1.00
R6798:Nrxn1 UTSW 17 90629950 missense probably damaging 1.00
R6923:Nrxn1 UTSW 17 91088233 missense probably benign 0.06
R7140:Nrxn1 UTSW 17 91088764 start gained probably benign
R7374:Nrxn1 UTSW 17 90588669 critical splice donor site probably null
R7564:Nrxn1 UTSW 17 90362906 missense possibly damaging 0.64
R7570:Nrxn1 UTSW 17 90162379 missense probably benign 0.35
X0021:Nrxn1 UTSW 17 90590212 missense probably damaging 1.00
X0063:Nrxn1 UTSW 17 90362831 missense possibly damaging 0.54
Z1088:Nrxn1 UTSW 17 90059505 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCACACCTAAGACAGTGG -3'
(R):5'- TATTGGGCTTGAAAACTGGCC -3'

Sequencing Primer
(F):5'- CACACCTAAGACAGTGGGGGATG -3'
(R):5'- GCTTGAAAACTGGCCCAGCTTC -3'
Posted On2019-06-07