Incidental Mutation 'PIT4466001:Dzank1'
ID555764
Institutional Source Beutler Lab
Gene Symbol Dzank1
Ensembl Gene ENSMUSG00000037259
Gene Namedouble zinc ribbon and ankyrin repeat domains 1
Synonyms2810039F03Rik, 6330439K17Rik, Ankrd64
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location144470557-144527414 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 144483373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 558 (I558T)
Ref Sequence ENSEMBL: ENSMUSP00000080643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081982] [ENSMUST00000163701]
Predicted Effect probably benign
Transcript: ENSMUST00000081982
AA Change: I558T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000080643
Gene: ENSMUSG00000037259
AA Change: I558T

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 11 99 1.1e-16 PFAM
Pfam:CHB_HEX_C_1 20 97 4.5e-18 PFAM
Pfam:Fn3_assoc 32 100 1.6e-17 PFAM
ZnF_RBZ 268 292 5.44e0 SMART
ZnF_RBZ 307 331 2.55e0 SMART
Blast:ZnF_RBZ 355 378 1e-7 BLAST
ZnF_RBZ 385 409 3.13e0 SMART
low complexity region 591 604 N/A INTRINSIC
ANK 631 662 2.97e2 SMART
ANK 666 695 2.83e0 SMART
Blast:ANK 700 731 7e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163701
AA Change: I559T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000133177
Gene: ENSMUSG00000037259
AA Change: I559T

DomainStartEndE-ValueType
Pfam:CHB_HEX_C 12 99 1.5e-17 PFAM
Pfam:CHB_HEX_C_1 21 97 8.5e-17 PFAM
Pfam:Fn3_assoc 32 100 3.7e-18 PFAM
ZnF_RBZ 269 293 5.44e0 SMART
ZnF_RBZ 308 332 2.55e0 SMART
Blast:ZnF_RBZ 356 379 1e-7 BLAST
ZnF_RBZ 386 410 3.13e0 SMART
low complexity region 592 605 N/A INTRINSIC
ANK 632 663 2.97e2 SMART
ANK 667 696 2.83e0 SMART
Blast:ANK 701 732 7e-12 BLAST
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene contains two ankyrin repeat-encoding regions. Ankyrin repeats are tandemly repeated modules of about 33 amino acids described as L-shaped structures consisting of a beta-hairpin and two alpha-helices. Ankyrin repeats occur in a large number of functionally diverse proteins, mainly from eukaryotes, and are known to function as protein-protein interaction domains. Alternative splicing has been observed for this gene but the full-length nature of additional variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Dzank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Dzank1 APN 2 144481725 nonsense probably null
IGL00955:Dzank1 APN 2 144490174 missense probably benign 0.22
IGL01888:Dzank1 APN 2 144476154 splice site probably null
IGL02108:Dzank1 APN 2 144506223 missense probably benign 0.02
IGL02979:Dzank1 APN 2 144488738 missense probably damaging 1.00
R0388:Dzank1 UTSW 2 144476106 missense possibly damaging 0.86
R0603:Dzank1 UTSW 2 144511512 missense probably benign 0.04
R1052:Dzank1 UTSW 2 144513445 missense probably benign
R1386:Dzank1 UTSW 2 144491831 missense probably benign 0.05
R1529:Dzank1 UTSW 2 144482188 missense probably benign 0.01
R1634:Dzank1 UTSW 2 144481669 missense probably benign 0.01
R2761:Dzank1 UTSW 2 144513449 missense probably benign
R4024:Dzank1 UTSW 2 144482227 missense probably benign
R4279:Dzank1 UTSW 2 144491845 missense probably benign 0.00
R4324:Dzank1 UTSW 2 144488698 missense possibly damaging 0.95
R4516:Dzank1 UTSW 2 144510122 intron probably benign
R4713:Dzank1 UTSW 2 144491804 missense probably benign 0.13
R4782:Dzank1 UTSW 2 144504399 missense probably damaging 1.00
R4994:Dzank1 UTSW 2 144522566 missense probably damaging 1.00
R5157:Dzank1 UTSW 2 144483412 missense probably damaging 0.98
R5514:Dzank1 UTSW 2 144481685 missense probably benign 0.01
R5580:Dzank1 UTSW 2 144506178 missense probably damaging 1.00
R5635:Dzank1 UTSW 2 144483407 missense probably damaging 1.00
R5793:Dzank1 UTSW 2 144506224 missense probably benign 0.14
R5820:Dzank1 UTSW 2 144513488 missense probably damaging 1.00
R5976:Dzank1 UTSW 2 144501489 missense probably damaging 1.00
R6935:Dzank1 UTSW 2 144476094 missense possibly damaging 0.64
R6980:Dzank1 UTSW 2 144490136 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CCTATGGAATTCGTTGTGAAAGTCAT -3'
(R):5'- CAAAAGTGATGTCTTAGCCATGCG -3'

Sequencing Primer
(F):5'- ATGGATCCTGACGTATACCTCTGAG -3'
(R):5'- CCATGCGTTTGACTGAAGGAAGTC -3'
Posted On2019-06-07