Incidental Mutation 'PIT4466001:Zfp644'
ID555774
Institutional Source Beutler Lab
Gene Symbol Zfp644
Ensembl Gene ENSMUSG00000049606
Gene Namezinc finger protein 644
SynonymsD5Ertd689e, 1110068L01Rik, Zep-2, BM-005
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location106616739-106697287 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106636477 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 735 (A735T)
Ref Sequence ENSEMBL: ENSMUSP00000038047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045466] [ENSMUST00000112695] [ENSMUST00000112696] [ENSMUST00000112698] [ENSMUST00000122980] [ENSMUST00000124263] [ENSMUST00000127434] [ENSMUST00000135108] [ENSMUST00000137285] [ENSMUST00000155495]
Predicted Effect probably damaging
Transcript: ENSMUST00000045466
AA Change: A735T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038047
Gene: ENSMUSG00000049606
AA Change: A735T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112695
SMART Domains Protein: ENSMUSP00000108315
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Blast:ZnF_C2H2 39 65 2e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112696
AA Change: A735T

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000108316
Gene: ENSMUSG00000049606
AA Change: A735T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 767 783 N/A INTRINSIC
low complexity region 802 819 N/A INTRINSIC
ZnF_C2H2 959 981 1.07e0 SMART
ZnF_C2H2 1034 1056 1.43e-1 SMART
low complexity region 1230 1243 N/A INTRINSIC
ZnF_C2H2 1257 1283 5.4e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112698
AA Change: A735T

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108318
Gene: ENSMUSG00000049606
AA Change: A735T

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
low complexity region 668 676 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
ZnF_C2H2 928 950 1.07e0 SMART
ZnF_C2H2 1003 1025 1.43e-1 SMART
low complexity region 1199 1212 N/A INTRINSIC
ZnF_C2H2 1226 1252 5.4e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122980
Predicted Effect probably benign
Transcript: ENSMUST00000124263
Predicted Effect probably benign
Transcript: ENSMUST00000127434
SMART Domains Protein: ENSMUSP00000122421
Gene: ENSMUSG00000049606

DomainStartEndE-ValueType
ZnF_C2H2 411 433 1.89e-1 SMART
ZnF_C2H2 449 471 6.52e-5 SMART
ZnF_C2H2 497 519 1.99e0 SMART
ZnF_C2H2 526 549 6.4e0 SMART
ZnF_C2H2 587 610 3.72e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135108
Predicted Effect probably benign
Transcript: ENSMUST00000137285
Predicted Effect probably benign
Transcript: ENSMUST00000155495
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor that may play a role in eye development. Defects in this gene have been associated with high myopia. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit normal blood lymphocyte populations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Other mutations in Zfp644
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Zfp644 APN 5 106638637 critical splice acceptor site probably null
IGL01654:Zfp644 APN 5 106635930 missense probably damaging 1.00
IGL01967:Zfp644 APN 5 106638243 missense probably damaging 1.00
IGL02132:Zfp644 APN 5 106635894 missense probably benign 0.22
IGL02164:Zfp644 APN 5 106638099 missense probably benign 0.01
IGL02303:Zfp644 APN 5 106637314 missense probably damaging 1.00
IGL03091:Zfp644 APN 5 106636858 missense probably damaging 1.00
IGL03102:Zfp644 APN 5 106637268 missense probably damaging 0.99
IGL03298:Zfp644 APN 5 106635101 missense possibly damaging 0.93
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0012:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0038:Zfp644 UTSW 5 106635043 missense probably benign 0.11
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0058:Zfp644 UTSW 5 106637003 missense possibly damaging 0.69
R0178:Zfp644 UTSW 5 106636905 missense probably damaging 1.00
R0497:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1302:Zfp644 UTSW 5 106634899 missense probably damaging 1.00
R1337:Zfp644 UTSW 5 106637554 missense probably damaging 0.99
R1400:Zfp644 UTSW 5 106637470 unclassified probably null
R1597:Zfp644 UTSW 5 106638333 missense probably damaging 0.99
R1911:Zfp644 UTSW 5 106635271 missense possibly damaging 0.95
R2021:Zfp644 UTSW 5 106635682 missense possibly damaging 0.84
R2196:Zfp644 UTSW 5 106638603 start codon destroyed probably null 0.02
R2256:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R2311:Zfp644 UTSW 5 106634956 missense probably benign 0.21
R2420:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2421:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R2422:Zfp644 UTSW 5 106637244 missense possibly damaging 0.95
R3752:Zfp644 UTSW 5 106636383 missense probably benign
R4207:Zfp644 UTSW 5 106618276 missense probably damaging 1.00
R4285:Zfp644 UTSW 5 106635118 missense probably damaging 1.00
R4874:Zfp644 UTSW 5 106635413 missense probably damaging 1.00
R4961:Zfp644 UTSW 5 106618215 utr 3 prime probably benign
R4984:Zfp644 UTSW 5 106636917 missense possibly damaging 0.96
R5007:Zfp644 UTSW 5 106636001 missense probably benign
R5358:Zfp644 UTSW 5 106635675 missense probably damaging 1.00
R5382:Zfp644 UTSW 5 106634869 missense possibly damaging 0.88
R5416:Zfp644 UTSW 5 106618428 splice site silent
R5641:Zfp644 UTSW 5 106619595 missense probably damaging 1.00
R5656:Zfp644 UTSW 5 106637982 missense probably benign 0.12
R5732:Zfp644 UTSW 5 106637123 missense probably damaging 1.00
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6039:Zfp644 UTSW 5 106635425 missense possibly damaging 0.93
R6306:Zfp644 UTSW 5 106638124 missense probably damaging 0.99
R6317:Zfp644 UTSW 5 106635845 missense probably damaging 1.00
R6354:Zfp644 UTSW 5 106636753 missense probably benign 0.23
R6886:Zfp644 UTSW 5 106637911 missense possibly damaging 0.53
R7223:Zfp644 UTSW 5 106637582 nonsense probably null
X0011:Zfp644 UTSW 5 106618427 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGAGCTTTCCTTCTTTGAGGC -3'
(R):5'- TCAAAATTTCATAAGCGGCCAC -3'

Sequencing Primer
(F):5'- GAGGCCTTAGCTACTCTTTTCACAG -3'
(R):5'- TTTCATAAGCGGCCACATAGAATAC -3'
Posted On2019-06-07