Incidental Mutation 'PIT4466001:Vmn1r168'
ID555782
Institutional Source Beutler Lab
Gene Symbol Vmn1r168
Ensembl Gene ENSMUSG00000074291
Gene Namevomeronasal 1 receptor 168
SynonymsGm10659
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location23540720-23541649 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23540996 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 93 (F93L)
Ref Sequence ENSEMBL: ENSMUSP00000096301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098704]
Predicted Effect probably damaging
Transcript: ENSMUST00000098704
AA Change: F93L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096301
Gene: ENSMUSG00000074291
AA Change: F93L

DomainStartEndE-ValueType
Pfam:TAS2R 8 296 1.1e-12 PFAM
Pfam:V1R 41 295 2.5e-14 PFAM
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Vmn1r168
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Vmn1r168 APN 7 23541645 missense possibly damaging 0.73
IGL02621:Vmn1r168 APN 7 23541355 missense probably damaging 1.00
IGL02650:Vmn1r168 APN 7 23541491 missense probably benign 0.13
R0320:Vmn1r168 UTSW 7 23541342 missense probably benign 0.12
R1595:Vmn1r168 UTSW 7 23541195 missense probably damaging 1.00
R1618:Vmn1r168 UTSW 7 23541300 missense probably benign 0.02
R1808:Vmn1r168 UTSW 7 23540759 missense probably benign 0.05
R2418:Vmn1r168 UTSW 7 23541399 missense probably benign 0.05
R2419:Vmn1r168 UTSW 7 23541399 missense probably benign 0.05
R4846:Vmn1r168 UTSW 7 23541065 missense probably damaging 1.00
R4864:Vmn1r168 UTSW 7 23541482 missense probably damaging 0.98
R5269:Vmn1r168 UTSW 7 23541414 missense probably benign 0.40
R6265:Vmn1r168 UTSW 7 23541536 missense probably benign
R6353:Vmn1r168 UTSW 7 23541519 missense probably benign 0.02
R6768:Vmn1r168 UTSW 7 23541035 missense probably damaging 1.00
R6921:Vmn1r168 UTSW 7 23540898 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACTATGGCTAACATTCTTCTG -3'
(R):5'- TGTGGACCACTGACTTTCATTG -3'

Sequencing Primer
(F):5'- ATGGCTAACATTCTTCTGTTTGTC -3'
(R):5'- CACTGACTTTCATTGGAATGTAGAC -3'
Posted On2019-06-07