Incidental Mutation 'PIT4466001:Ilf3'
ID555788
Institutional Source Beutler Lab
Gene Symbol Ilf3
Ensembl Gene ENSMUSG00000032178
Gene Nameinterleukin enhancer binding factor 3
SynonymsNF90
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21367871-21405361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21403366 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 765 (Y765H)
Ref Sequence ENSEMBL: ENSMUSP00000065770 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067646] [ENSMUST00000115414] [ENSMUST00000213518] [ENSMUST00000213603] [ENSMUST00000214758] [ENSMUST00000216892] [ENSMUST00000217348]
PDB Structure
Crystal structure of the NF90-NF45 dimerisation domain complex [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with ATP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with UTP [X-RAY DIFFRACTION]
Crystal structure of the NF90-NF45 dimerisation domain complex with CTP [X-RAY DIFFRACTION]
Predicted Effect unknown
Transcript: ENSMUST00000067646
AA Change: Y765H
SMART Domains Protein: ENSMUSP00000065770
Gene: ENSMUSG00000032178
AA Change: Y765H

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
low complexity region 691 725 N/A INTRINSIC
low complexity region 745 769 N/A INTRINSIC
low complexity region 777 807 N/A INTRINSIC
low complexity region 810 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115414
SMART Domains Protein: ENSMUSP00000111074
Gene: ENSMUSG00000032178

DomainStartEndE-ValueType
DZF 88 342 3.87e-166 SMART
low complexity region 375 396 N/A INTRINSIC
DSRM 402 466 2.2e-16 SMART
low complexity region 490 508 N/A INTRINSIC
DSRM 525 589 2.73e-21 SMART
low complexity region 638 688 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000213518
AA Change: Y778H
Predicted Effect unknown
Transcript: ENSMUST00000213603
AA Change: Y778H
Predicted Effect unknown
Transcript: ENSMUST00000214758
AA Change: Y778H
Predicted Effect probably benign
Transcript: ENSMUST00000215169
Predicted Effect probably benign
Transcript: ENSMUST00000216892
Predicted Effect probably benign
Transcript: ENSMUST00000217348
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene contains two double-stranded RNA binding domains and functions in the post-transcriptional regulation of gene expression. It is a component of an RNA-protein complex that may be involved in mediating the export of messenger RNAs. Alternative splicing results in multiple transcript variants encoding distinct isoforms. These isoforms are grouped into two categories, NFAR-1 or NFAR-2, based on variation at the C-terminus. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are born small and weak, show tachypnea and multi-organ apoptosis, and die neonatally due to neuromuscular respiratory failure. The diaphragm and other skeletal muscles show disorganization and paucity of myofibers,myocyte degeneration and elevated apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Ilf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Ilf3 APN 9 21396051 missense probably damaging 1.00
IGL01013:Ilf3 APN 9 21399691 missense possibly damaging 0.91
IGL01352:Ilf3 APN 9 21392322 missense possibly damaging 0.89
IGL01975:Ilf3 APN 9 21392379 missense probably benign 0.03
IGL02826:Ilf3 APN 9 21398044 missense probably benign 0.20
IGL03238:Ilf3 APN 9 21392350 missense probably damaging 1.00
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0047:Ilf3 UTSW 9 21388714 missense possibly damaging 0.76
R0090:Ilf3 UTSW 9 21395414 missense probably damaging 1.00
R0355:Ilf3 UTSW 9 21397970 missense probably damaging 1.00
R1768:Ilf3 UTSW 9 21403142 unclassified probably benign
R1889:Ilf3 UTSW 9 21404767 unclassified probably benign
R1895:Ilf3 UTSW 9 21404767 unclassified probably benign
R1918:Ilf3 UTSW 9 21393714 missense probably damaging 1.00
R2930:Ilf3 UTSW 9 21399590 missense possibly damaging 0.91
R3912:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R3913:Ilf3 UTSW 9 21398126 missense possibly damaging 0.77
R4080:Ilf3 UTSW 9 21403134 critical splice acceptor site probably null
R4412:Ilf3 UTSW 9 21399560 missense possibly damaging 0.77
R4510:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R4511:Ilf3 UTSW 9 21399215 missense possibly damaging 0.95
R5201:Ilf3 UTSW 9 21389383 missense probably damaging 1.00
R5785:Ilf3 UTSW 9 21394872 missense probably damaging 1.00
R6303:Ilf3 UTSW 9 21403136 unclassified probably benign
R6406:Ilf3 UTSW 9 21396244 missense probably damaging 0.99
R6434:Ilf3 UTSW 9 21403151 unclassified probably benign
R7169:Ilf3 UTSW 9 21395426 missense probably damaging 0.96
X0066:Ilf3 UTSW 9 21392406 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAATGGAGGGCATTCTGG -3'
(R):5'- TCACAGTTCCTGGCTAGAGC -3'

Sequencing Primer
(F):5'- CATTCTGGGAATGCCGGTG -3'
(R):5'- CTGGCTAGAGCTGGGCTTC -3'
Posted On2019-06-07