Incidental Mutation 'PIT4466001:Gpaa1'
ID555801
Institutional Source Beutler Lab
Gene Symbol Gpaa1
Ensembl Gene ENSMUSG00000022561
Gene NameGPI anchor attachment protein 1
SynonymsmGAA1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location76331231-76334907 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76334740 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 594 (T594I)
Ref Sequence ENSEMBL: ENSMUSP00000023221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023221] [ENSMUST00000059045] [ENSMUST00000164972] [ENSMUST00000169378] [ENSMUST00000170121] [ENSMUST00000172281] [ENSMUST00000230512]
Predicted Effect probably benign
Transcript: ENSMUST00000023221
AA Change: T594I

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023221
Gene: ENSMUSG00000022561
AA Change: T594I

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
Pfam:Gaa1 125 615 3.8e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059045
SMART Domains Protein: ENSMUSP00000050940
Gene: ENSMUSG00000034259

DomainStartEndE-ValueType
Pfam:RNase_PH 21 152 5.1e-37 PFAM
Pfam:RNase_PH_C 155 220 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164972
SMART Domains Protein: ENSMUSP00000127108
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169378
SMART Domains Protein: ENSMUSP00000128507
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170121
SMART Domains Protein: ENSMUSP00000133173
Gene: ENSMUSG00000022561

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172281
AA Change: T534I

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000132986
Gene: ENSMUSG00000022561
AA Change: T534I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Gaa1 64 560 3e-205 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000230512
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational glycosylphosphatidylinositol (GPI) anchor attachment serves as a general mechanism for linking proteins to the cell surface membrane. The protein encoded by this gene presumably functions in GPI anchoring at the GPI transfer step. The mRNA transcript is ubiquitously expressed in both fetal and adult tissues. The anchor attachment protein 1 contains an N-terminal signal sequence, 1 cAMP- and cGMP-dependent protein kinase phosphorylation site, 1 leucine zipper pattern, 2 potential N-glycosylation sites, and 8 putative transmembrane domains. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nlrc4 A G 17: 74,427,119 M933T probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Gpaa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Gpaa1 APN 15 76332998 missense probably benign
IGL02040:Gpaa1 APN 15 76334295 missense probably benign 0.17
IGL02162:Gpaa1 APN 15 76332153 unclassified probably benign
IGL02430:Gpaa1 APN 15 76332188 missense possibly damaging 0.93
IGL02951:Gpaa1 APN 15 76332819 unclassified probably benign
PIT4472001:Gpaa1 UTSW 15 76334740 missense probably benign 0.03
R0137:Gpaa1 UTSW 15 76334781 missense probably damaging 1.00
R0458:Gpaa1 UTSW 15 76332033 missense probably benign 0.06
R0760:Gpaa1 UTSW 15 76331919 missense probably benign 0.01
R1681:Gpaa1 UTSW 15 76331453 missense probably benign
R1691:Gpaa1 UTSW 15 76332216 missense probably damaging 0.99
R2124:Gpaa1 UTSW 15 76333352 missense probably damaging 1.00
R4165:Gpaa1 UTSW 15 76332467 unclassified probably benign
R4166:Gpaa1 UTSW 15 76332467 unclassified probably benign
R4775:Gpaa1 UTSW 15 76334691 unclassified probably null
R4844:Gpaa1 UTSW 15 76332308 unclassified probably benign
R5007:Gpaa1 UTSW 15 76331668 nonsense probably null
R5331:Gpaa1 UTSW 15 76332311 unclassified probably benign
R5804:Gpaa1 UTSW 15 76332626 missense probably damaging 1.00
R5828:Gpaa1 UTSW 15 76332271 unclassified probably benign
R6221:Gpaa1 UTSW 15 76333832 missense probably benign 0.00
Z1088:Gpaa1 UTSW 15 76332542 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTCCCCAGGACACTGTATG -3'
(R):5'- TCCTCTAAAGGGGCGAACAG -3'

Sequencing Primer
(F):5'- AGGACACTGTATGCTGCCCTG -3'
(R):5'- CTCTGAGAAGACAGCGGGC -3'
Posted On2019-06-07