Incidental Mutation 'PIT4466001:Nlrc4'
ID555808
Institutional Source Beutler Lab
Gene Symbol Nlrc4
Ensembl Gene ENSMUSG00000039193
Gene NameNLR family, CARD domain containing 4
SynonymsCard12, Ipaf, 9530011P19Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #PIT4466001 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location74426295-74459108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74427119 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 933 (M933T)
Ref Sequence ENSEMBL: ENSMUSP00000059637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024870] [ENSMUST00000052124] [ENSMUST00000179074]
PDB Structure
Crystal structure of NLRC4 reveals its autoinhibition mechanism [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000024870
SMART Domains Protein: ENSMUSP00000024870
Gene: ENSMUSG00000024069

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 336 6.9e-45 PFAM
low complexity region 371 392 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052124
AA Change: M933T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000059637
Gene: ENSMUSG00000039193
AA Change: M933T

DomainStartEndE-ValueType
Pfam:CARD 1 87 1.4e-20 PFAM
Pfam:NACHT 163 314 1.3e-28 PFAM
SCOP:d1yrga_ 734 1015 3e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179074
SMART Domains Protein: ENSMUSP00000136503
Gene: ENSMUSG00000024069

DomainStartEndE-ValueType
Pfam:Cation_efflux 34 260 5.7e-30 PFAM
low complexity region 376 397 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.5%
  • 3x: 90.9%
  • 10x: 85.1%
  • 20x: 72.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the caspase recruitment domain-containing NLR family. Family members play essential roles in innate immune response to a wide range of pathogenic organisms, tissue damage and other cellular stresses. Mutations in this gene result in autoinflammation with infantile enterocolitis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null allele show lack of caspase-1 activation in macrophages infected with Legionella and Salmonella, and enhanced permissivity to Legionella replication. Homozygotes for another null allele fail to show caspase dependent cell death andIL-1beta secretion upon Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Adamts1 C A 16: 85,796,691 G719* probably null Het
Ano5 G T 7: 51,544,851 D111Y probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
AU021092 T A 16: 5,220,389 S85C probably damaging Het
C87414 A C 5: 93,636,288 L439R probably damaging Het
Capn5 T C 7: 98,123,988 D603G probably benign Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cdr1 AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC AAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCAGAAGTCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCCGAAAATCCAAGTCTTCCC X: 61,184,524 probably benign Het
Cep112 A G 11: 108,519,896 T553A probably benign Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cntnap1 T C 11: 101,177,305 F48L probably benign Het
Cyb5r3 T C 15: 83,161,863 D84G probably damaging Het
Ddx47 T C 6: 135,015,840 I154T probably benign Het
Dnah6 A G 6: 73,208,641 L99P probably benign Het
Dzank1 A G 2: 144,483,373 I558T probably benign Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Fndc1 A G 17: 7,750,374 L1553P probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gm3099 A G 14: 4,000,549 M128V probably benign Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Hck C T 2: 153,124,271 T55M probably damaging Het
Hectd4 T C 5: 121,333,060 probably null Het
Ica1l C T 1: 60,015,836 probably null Het
Ilf3 T C 9: 21,403,366 Y765H unknown Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mfsd6 T C 1: 52,708,897 T270A probably benign Het
Mib1 G A 18: 10,775,541 D498N probably benign Het
Naaladl1 A T 19: 6,114,633 T576S possibly damaging Het
Ncoa6 A T 2: 155,405,657 I1909N probably benign Het
Negr1 A G 3: 156,859,598 D107G probably benign Het
Nmnat3 T G 9: 98,410,253 F184V probably benign Het
Olfr1271 A T 2: 90,266,295 V45E probably damaging Het
Olfr510 T C 7: 108,667,536 V40A possibly damaging Het
Olfr8 C A 10: 78,955,842 F212L probably benign Het
Olfr809 C T 10: 129,776,273 R120C probably benign Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pgm5 T G 19: 24,824,329 Q178H probably damaging Het
Phrf1 C T 7: 141,258,812 T640M unknown Het
Psg18 T G 7: 18,349,316 T305P probably benign Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Slc36a1 C A 11: 55,219,069 P68T probably damaging Het
Smim6 T C 11: 115,913,545 F53L probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trrap T A 5: 144,828,600 V2523D probably benign Het
Usp9y A T Y: 1,432,197 D429E probably damaging Het
Vmn1r125 A G 7: 21,272,893 T239A probably benign Het
Vmn1r168 T C 7: 23,540,996 F93L probably damaging Het
Vmn1r88 A G 7: 13,178,476 N253S possibly damaging Het
Zfp644 C T 5: 106,636,477 A735T probably damaging Het
Other mutations in Nlrc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Nlrc4 APN 17 74446534 missense probably benign 0.02
IGL00427:Nlrc4 APN 17 74447092 missense probably benign
IGL00823:Nlrc4 APN 17 74447990 missense probably benign 0.01
IGL01404:Nlrc4 APN 17 74445711 missense probably damaging 1.00
IGL02178:Nlrc4 APN 17 74446843 missense probably damaging 1.00
IGL02266:Nlrc4 APN 17 74446167 missense possibly damaging 0.72
IGL03342:Nlrc4 APN 17 74445318 missense probably damaging 1.00
inwood UTSW 17 74445630 missense probably damaging 1.00
PIT4305001:Nlrc4 UTSW 17 74446309 missense probably damaging 0.99
R0077:Nlrc4 UTSW 17 74446831 missense probably damaging 1.00
R0398:Nlrc4 UTSW 17 74445920 missense probably damaging 0.99
R0639:Nlrc4 UTSW 17 74426963 missense probably benign 0.16
R1498:Nlrc4 UTSW 17 74446413 missense probably benign 0.43
R1565:Nlrc4 UTSW 17 74441931 missense probably benign 0.00
R1624:Nlrc4 UTSW 17 74445189 missense possibly damaging 0.55
R1666:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1668:Nlrc4 UTSW 17 74445906 missense probably damaging 0.97
R1690:Nlrc4 UTSW 17 74437523 nonsense probably null
R1723:Nlrc4 UTSW 17 74441908 missense probably damaging 1.00
R1988:Nlrc4 UTSW 17 74426943 missense probably benign 0.09
R1992:Nlrc4 UTSW 17 74445633 missense probably benign 0.04
R2141:Nlrc4 UTSW 17 74447951 splice site probably benign
R2256:Nlrc4 UTSW 17 74445630 missense probably damaging 1.00
R2897:Nlrc4 UTSW 17 74448045 missense probably benign
R3117:Nlrc4 UTSW 17 74436068 missense probably benign 0.00
R3861:Nlrc4 UTSW 17 74445621 missense probably benign 0.00
R4093:Nlrc4 UTSW 17 74445958 missense probably benign 0.20
R4212:Nlrc4 UTSW 17 74447115 missense possibly damaging 0.66
R4627:Nlrc4 UTSW 17 74446628 missense probably damaging 1.00
R4859:Nlrc4 UTSW 17 74436037 missense probably damaging 0.97
R4968:Nlrc4 UTSW 17 74446941 missense probably benign 0.20
R5133:Nlrc4 UTSW 17 74446717 missense possibly damaging 0.91
R5379:Nlrc4 UTSW 17 74448083 nonsense probably null
R6045:Nlrc4 UTSW 17 74446959 missense probably damaging 0.98
R6654:Nlrc4 UTSW 17 74445528 missense possibly damaging 0.55
R6712:Nlrc4 UTSW 17 74446836 missense probably damaging 0.96
R6976:Nlrc4 UTSW 17 74445939 missense probably damaging 1.00
R7030:Nlrc4 UTSW 17 74446006 missense probably damaging 1.00
R7153:Nlrc4 UTSW 17 74447103 missense possibly damaging 0.84
R7190:Nlrc4 UTSW 17 74445203 missense probably damaging 1.00
R7398:Nlrc4 UTSW 17 74446542 missense probably damaging 1.00
R7417:Nlrc4 UTSW 17 74446488 missense probably benign 0.18
R7468:Nlrc4 UTSW 17 74445512 missense probably benign 0.00
X0026:Nlrc4 UTSW 17 74446643 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGAGCTTTACCTCTTGCAGAAG -3'
(R):5'- TGTGAATACTGTGGGCAGGC -3'

Sequencing Primer
(F):5'- TGCAGAAGAGTTAACTTGGATAACAC -3'
(R):5'- TGTGGGCAGGCACAGAAC -3'
Posted On2019-06-07