Incidental Mutation 'R0604:Aqr'
ID 55582
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
MMRRC Submission 038793-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0604 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 113931642-114005788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113961085 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 725 (K725R)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably benign
Transcript: ENSMUST00000043160
AA Change: K725R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: K725R

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000102543
AA Change: K725R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: K725R

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126701
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 T C 11: 69,775,451 (GRCm39) E302G probably benign Het
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Adrb2 G A 18: 62,311,586 (GRCm39) T413I possibly damaging Het
Braf A G 6: 39,600,631 (GRCm39) I662T probably damaging Het
Ccdc178 A G 18: 22,200,500 (GRCm39) S435P probably benign Het
Chd9 A G 8: 91,763,170 (GRCm39) M2332V possibly damaging Het
Clgn T C 8: 84,150,823 (GRCm39) V496A probably benign Het
Dnah17 A C 11: 118,012,297 (GRCm39) S193R probably benign Het
Dntt A G 19: 41,041,588 (GRCm39) E424G probably benign Het
Fam149a A G 8: 45,798,045 (GRCm39) L492P probably damaging Het
Fetub T C 16: 22,754,410 (GRCm39) Y126H possibly damaging Het
Fgfr3 A T 5: 33,890,126 (GRCm39) Y96F probably damaging Het
Gm4952 A G 19: 12,602,036 (GRCm39) E148G probably benign Het
Gucy2g T A 19: 55,191,519 (GRCm39) L977F probably benign Het
Il1r1 T C 1: 40,321,406 (GRCm39) V6A probably benign Het
Itsn2 C A 12: 4,708,189 (GRCm39) Q832K probably benign Het
Lats1 T A 10: 7,588,425 (GRCm39) F1014Y probably damaging Het
Mcc G A 18: 44,606,823 (GRCm39) A536V probably damaging Het
Mtrf1 T C 14: 79,653,327 (GRCm39) V334A possibly damaging Het
Or1j21 T A 2: 36,684,119 (GRCm39) Y290* probably null Het
Or2t46 T A 11: 58,472,174 (GRCm39) M168K probably damaging Het
Or2z8 C T 8: 72,812,244 (GRCm39) T240M probably damaging Het
Or4p18 T C 2: 88,232,727 (GRCm39) T184A probably benign Het
Pard6g A G 18: 80,160,423 (GRCm39) S179G probably damaging Het
Pierce1 C A 2: 28,356,103 (GRCm39) R60L possibly damaging Het
Polr3a G A 14: 24,534,232 (GRCm39) P91L probably damaging Het
Psg27 A T 7: 18,290,997 (GRCm39) V402D probably damaging Het
Rttn A G 18: 88,995,882 (GRCm39) I222V probably damaging Het
Sp9 T A 2: 73,103,982 (GRCm39) S179T probably benign Het
Tbc1d8 T A 1: 39,444,407 (GRCm39) H184L probably damaging Het
Vmn1r69 A G 7: 10,314,581 (GRCm39) V50A probably benign Het
Vmn2r58 A G 7: 41,510,000 (GRCm39) F526L possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 113,956,423 (GRCm39) missense possibly damaging 0.90
IGL00694:Aqr APN 2 113,982,006 (GRCm39) missense probably damaging 1.00
IGL02113:Aqr APN 2 113,950,508 (GRCm39) nonsense probably null
IGL02297:Aqr APN 2 113,980,962 (GRCm39) missense probably benign 0.24
IGL02380:Aqr APN 2 113,940,417 (GRCm39) missense probably damaging 1.00
IGL02410:Aqr APN 2 113,967,398 (GRCm39) missense possibly damaging 0.85
IGL02413:Aqr APN 2 113,949,261 (GRCm39) missense possibly damaging 0.87
IGL02474:Aqr APN 2 113,943,127 (GRCm39) missense probably damaging 1.00
IGL02941:Aqr APN 2 113,943,835 (GRCm39) missense probably damaging 1.00
IGL02981:Aqr APN 2 113,965,305 (GRCm39) splice site probably benign
IGL03001:Aqr APN 2 113,977,400 (GRCm39) missense probably benign
IGL03092:Aqr APN 2 113,989,424 (GRCm39) missense probably benign 0.38
IGL03222:Aqr APN 2 113,951,737 (GRCm39) missense probably damaging 1.00
capricorn UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
Goat UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
Pliades UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
sagittarius UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
Zodiac UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 113,961,215 (GRCm39) missense possibly damaging 0.94
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0152:Aqr UTSW 2 113,989,491 (GRCm39) missense probably benign 0.07
R0352:Aqr UTSW 2 114,000,533 (GRCm39) missense probably damaging 1.00
R0371:Aqr UTSW 2 113,988,085 (GRCm39) missense possibly damaging 0.80
R0374:Aqr UTSW 2 113,961,092 (GRCm39) missense probably damaging 1.00
R0550:Aqr UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
R0685:Aqr UTSW 2 113,971,458 (GRCm39) missense probably damaging 1.00
R1236:Aqr UTSW 2 113,947,136 (GRCm39) missense probably damaging 1.00
R1434:Aqr UTSW 2 113,980,890 (GRCm39) missense probably damaging 1.00
R1806:Aqr UTSW 2 113,992,133 (GRCm39) missense probably damaging 1.00
R2154:Aqr UTSW 2 113,967,485 (GRCm39) missense probably damaging 1.00
R2185:Aqr UTSW 2 113,961,015 (GRCm39) critical splice donor site probably null
R2377:Aqr UTSW 2 113,971,421 (GRCm39) missense possibly damaging 0.58
R2862:Aqr UTSW 2 113,967,398 (GRCm39) missense probably damaging 1.00
R3615:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3616:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3713:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R3715:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R4586:Aqr UTSW 2 113,943,058 (GRCm39) missense probably benign 0.06
R4663:Aqr UTSW 2 113,992,147 (GRCm39) nonsense probably null
R4809:Aqr UTSW 2 114,005,695 (GRCm39) utr 5 prime probably benign
R4887:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4888:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4952:Aqr UTSW 2 113,940,418 (GRCm39) missense probably damaging 1.00
R4974:Aqr UTSW 2 113,943,832 (GRCm39) missense probably damaging 1.00
R5050:Aqr UTSW 2 114,000,506 (GRCm39) critical splice donor site probably null
R5050:Aqr UTSW 2 113,943,090 (GRCm39) nonsense probably null
R5213:Aqr UTSW 2 113,943,808 (GRCm39) missense probably damaging 1.00
R5263:Aqr UTSW 2 113,947,059 (GRCm39) missense probably damaging 1.00
R5470:Aqr UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
R5488:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5489:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5567:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5570:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5641:Aqr UTSW 2 113,979,515 (GRCm39) missense probably damaging 1.00
R5685:Aqr UTSW 2 113,986,746 (GRCm39) missense possibly damaging 0.87
R5963:Aqr UTSW 2 113,957,442 (GRCm39) missense probably damaging 1.00
R5992:Aqr UTSW 2 113,973,530 (GRCm39) nonsense probably null
R6015:Aqr UTSW 2 114,005,646 (GRCm39) start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 113,986,758 (GRCm39) missense possibly damaging 0.93
R6264:Aqr UTSW 2 113,940,445 (GRCm39) missense probably damaging 1.00
R6773:Aqr UTSW 2 113,979,477 (GRCm39) missense possibly damaging 0.64
R6877:Aqr UTSW 2 113,947,052 (GRCm39) nonsense probably null
R7211:Aqr UTSW 2 113,965,204 (GRCm39) missense probably benign 0.01
R7232:Aqr UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
R7308:Aqr UTSW 2 113,934,543 (GRCm39) missense possibly damaging 0.86
R7396:Aqr UTSW 2 113,950,427 (GRCm39) nonsense probably null
R7490:Aqr UTSW 2 113,989,349 (GRCm39) critical splice donor site probably null
R7526:Aqr UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
R7629:Aqr UTSW 2 113,945,074 (GRCm39) missense probably damaging 1.00
R7828:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R8037:Aqr UTSW 2 113,992,161 (GRCm39) missense probably damaging 1.00
R8166:Aqr UTSW 2 113,943,806 (GRCm39) missense possibly damaging 0.95
R8712:Aqr UTSW 2 113,949,358 (GRCm39) missense probably damaging 1.00
R8904:Aqr UTSW 2 113,967,474 (GRCm39) missense probably damaging 0.98
R9487:Aqr UTSW 2 113,934,528 (GRCm39) missense probably benign 0.04
R9527:Aqr UTSW 2 113,932,037 (GRCm39) missense probably benign 0.02
R9664:Aqr UTSW 2 113,971,396 (GRCm39) nonsense probably null
Z1176:Aqr UTSW 2 113,940,472 (GRCm39) missense probably benign 0.25
Z1176:Aqr UTSW 2 113,938,603 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGACTGCCAAAATGAAGTCCAGAC -3'
(R):5'- TGTTCAATAGGAGTCAAGCGGCAAG -3'

Sequencing Primer
(F):5'- CACAATGCTTAAAACTCACTTAGTC -3'
(R):5'- GCAGAAAGTAGCTTCTTGCC -3'
Posted On 2013-07-11