Incidental Mutation 'PIT4469001:Atp13a2'
ID555821
Institutional Source Beutler Lab
Gene Symbol Atp13a2
Ensembl Gene ENSMUSG00000036622
Gene NameATPase type 13A2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4469001 (G1)
Quality Score123.008
Status Not validated
Chromosome4
Chromosomal Location140986873-141007330 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140994127 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 176 (V176E)
Ref Sequence ENSEMBL: ENSMUSP00000126461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037055] [ENSMUST00000127833] [ENSMUST00000168047]
Predicted Effect probably benign
Transcript: ENSMUST00000037055
SMART Domains Protein: ENSMUSP00000039648
Gene: ENSMUSG00000036622

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 171 8.9e-27 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 497 3.6e-39 PFAM
Pfam:Hydrolase 502 785 2e-14 PFAM
Pfam:HAD 505 876 3.6e-27 PFAM
transmembrane domain 920 942 N/A INTRINSIC
transmembrane domain 957 979 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
transmembrane domain 1033 1055 N/A INTRINSIC
transmembrane domain 1068 1090 N/A INTRINSIC
transmembrane domain 1105 1127 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127833
SMART Domains Protein: ENSMUSP00000132183
Gene: ENSMUSG00000036622

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 164 7.4e-29 PFAM
Cation_ATPase_N 179 251 9.78e-1 SMART
Pfam:E1-E2_ATPase 256 496 6e-34 PFAM
Pfam:HAD 505 876 4e-27 PFAM
Pfam:Hydrolase 663 879 2.5e-15 PFAM
transmembrane domain 925 947 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
transmembrane domain 991 1013 N/A INTRINSIC
low complexity region 1102 1115 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168047
AA Change: V176E
SMART Domains Protein: ENSMUSP00000126461
Gene: ENSMUSG00000036622
AA Change: V176E

DomainStartEndE-ValueType
Pfam:P5-ATPase 31 156 1e-27 PFAM
Cation_ATPase_N 262 334 9.78e-1 SMART
Pfam:E1-E2_ATPase 339 579 4.8e-34 PFAM
Pfam:HAD 588 959 3e-27 PFAM
Pfam:Hydrolase 726 962 1.8e-15 PFAM
Coding Region Coverage
  • 1x: 93.3%
  • 3x: 90.7%
  • 10x: 84.4%
  • 20x: 71.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P5 subfamily of ATPases which transports inorganic cations as well as other substrates. Mutations in this gene are associated with Kufor-Rakeb syndrome (KRS), also referred to as Parkinson disease 9. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neuronal ceroid lipofuscinosis, synuclein accumulation and age-dependent sensorimotor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030408B16Rik T C 15: 101,293,271 V6A probably benign Het
A630001G21Rik A G 1: 85,725,199 F83L probably benign Het
Acsm2 T A 7: 119,578,185 C308S possibly damaging Het
Ak3 A G 19: 29,047,757 S25P probably damaging Het
Bmper A T 9: 23,406,549 H488L probably benign Het
Cacna1c A T 6: 118,595,972 C2084S unknown Het
Ccp110 T A 7: 118,722,377 N418K probably benign Het
Ddx17 C A 15: 79,543,813 G32C probably damaging Het
Dusp16 G A 6: 134,761,152 probably benign Het
Efl1 T G 7: 82,658,165 F90V probably benign Het
Ell2 T A 13: 75,761,892 N252K probably damaging Het
Gdf6 T C 4: 9,859,569 V217A probably damaging Het
Gm6205 T A 5: 94,682,793 V50E probably damaging Het
Hint1 T A 11: 54,870,070 S112T unknown Het
Hist1h1e A T 13: 23,622,379 V40E probably damaging Het
Kif5c T C 2: 49,741,348 V679A probably benign Het
Lrrn3 A T 12: 41,453,018 D433E probably benign Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Naa11 A G 5: 97,391,626 probably null Het
Pcdh18 T A 3: 49,755,069 H599L probably benign Het
Pgc A T 17: 47,728,755 K25* probably null Het
Psd4 G A 2: 24,394,294 D57N probably benign Het
Pxdn G A 12: 30,005,829 R1238Q probably benign Het
Spata32 T C 11: 103,209,827 N38S probably benign Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Tpr A G 1: 150,403,956 T279A probably benign Het
Unc13a C A 8: 71,658,314 E418* probably null Het
Vmn2r97 C A 17: 18,929,616 T422K probably benign Het
Zfp474 A T 18: 52,638,719 Q148L possibly damaging Het
Other mutations in Atp13a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Atp13a2 APN 4 140992198 missense probably benign 0.02
IGL01476:Atp13a2 APN 4 141000770 missense probably damaging 1.00
IGL01980:Atp13a2 APN 4 141006152 missense probably benign 0.00
IGL02257:Atp13a2 APN 4 141006089 missense probably benign 0.00
IGL02589:Atp13a2 APN 4 141006411 missense probably damaging 1.00
IGL02936:Atp13a2 APN 4 141001949 missense probably benign 0.00
IGL03032:Atp13a2 APN 4 141000355 missense possibly damaging 0.95
IGL03040:Atp13a2 APN 4 141006173 missense probably damaging 1.00
IGL03271:Atp13a2 APN 4 141000397 missense possibly damaging 0.69
calla UTSW 4 140994332 nonsense probably null
eastern_moon UTSW 4 141005016 missense probably damaging 0.99
yucca_brevifolia UTSW 4 140993802 missense probably damaging 1.00
IGL03054:Atp13a2 UTSW 4 141006968 missense possibly damaging 0.83
R0634:Atp13a2 UTSW 4 141006929 unclassified probably benign
R0881:Atp13a2 UTSW 4 141003931 missense probably damaging 1.00
R1295:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1296:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1472:Atp13a2 UTSW 4 140993802 missense probably damaging 1.00
R1780:Atp13a2 UTSW 4 141002460 missense possibly damaging 0.73
R1837:Atp13a2 UTSW 4 140994332 nonsense probably null
R1838:Atp13a2 UTSW 4 140994332 nonsense probably null
R1856:Atp13a2 UTSW 4 141004012 missense probably benign 0.43
R1918:Atp13a2 UTSW 4 140996371 missense possibly damaging 0.90
R1956:Atp13a2 UTSW 4 141004261 missense possibly damaging 0.92
R2126:Atp13a2 UTSW 4 140995391 missense possibly damaging 0.94
R2130:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2132:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2133:Atp13a2 UTSW 4 141005016 missense probably damaging 0.99
R2397:Atp13a2 UTSW 4 141003155 missense probably benign 0.00
R2873:Atp13a2 UTSW 4 141002983 missense probably benign 0.00
R3025:Atp13a2 UTSW 4 140994348 missense probably damaging 1.00
R3939:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3940:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R3942:Atp13a2 UTSW 4 141006422 missense probably damaging 0.98
R4247:Atp13a2 UTSW 4 140992228 critical splice donor site probably null
R4357:Atp13a2 UTSW 4 141001904 missense probably benign 0.01
R4406:Atp13a2 UTSW 4 141006476 missense probably damaging 1.00
R4686:Atp13a2 UTSW 4 141003276 critical splice donor site probably null
R5033:Atp13a2 UTSW 4 141000821 missense possibly damaging 0.91
R5066:Atp13a2 UTSW 4 141005138 missense probably damaging 1.00
R5278:Atp13a2 UTSW 4 141000818 missense probably damaging 0.97
R5464:Atp13a2 UTSW 4 141006070 missense probably damaging 1.00
R5522:Atp13a2 UTSW 4 141004360 splice site probably null
R5614:Atp13a2 UTSW 4 140992182 missense probably benign 0.35
R5846:Atp13a2 UTSW 4 140995596 missense possibly damaging 0.81
R6378:Atp13a2 UTSW 4 141007056 missense probably benign 0.34
R6512:Atp13a2 UTSW 4 141003218 missense probably damaging 1.00
R6518:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R6519:Atp13a2 UTSW 4 141000854 missense possibly damaging 0.89
R7166:Atp13a2 UTSW 4 141006984 missense possibly damaging 0.89
R7178:Atp13a2 UTSW 4 140999151 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGAGCTGCTGAGTAACTCTC -3'
(R):5'- AGTACCTGCTTCTGGGTGAG -3'

Sequencing Primer
(F):5'- AACCCTCTCCAGCCTGG -3'
(R):5'- CCTGCTTCTGGGTGAGAGAGG -3'
Posted On2019-06-07