Incidental Mutation 'PIT4472001:Mnx1'
ID555854
Institutional Source Beutler Lab
Gene Symbol Mnx1
Ensembl Gene ENSMUSG00000001566
Gene Namemotor neuron and pancreas homeobox 1
SynonymsHlxb9, HB9, MNR2
Accession Numbers

Genbank: NM_019944; MGI: 109160

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4472001 (G1)
Quality Score142.008
Status Not validated
Chromosome5
Chromosomal Location29473034-29478470 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29474107 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 326 (E326G)
Ref Sequence ENSEMBL: ENSMUSP00000129503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001608] [ENSMUST00000165512]
Predicted Effect unknown
Transcript: ENSMUST00000001608
AA Change: E326G
SMART Domains Protein: ENSMUSP00000001608
Gene: ENSMUSG00000001566
AA Change: E326G

DomainStartEndE-ValueType
low complexity region 39 64 N/A INTRINSIC
low complexity region 90 158 N/A INTRINSIC
low complexity region 168 176 N/A INTRINSIC
HOX 241 303 1.39e-25 SMART
low complexity region 346 366 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165512
AA Change: E326G
SMART Domains Protein: ENSMUSP00000129503
Gene: ENSMUSG00000001566
AA Change: E326G

DomainStartEndE-ValueType
low complexity region 39 64 N/A INTRINSIC
low complexity region 90 158 N/A INTRINSIC
low complexity region 168 176 N/A INTRINSIC
HOX 241 303 1.39e-25 SMART
low complexity region 346 366 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which contains a homeobox domain and is a transcription factor. Mutations in this gene result in Currarino syndrome, an autosomic dominant congenital malformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice die at birth exhibiting pancreas dorsal lobe agenesis, small pancreatic islets, and aberrant beta-cell function and motor axon guidance. Mice homozygous for other reporter/null alleles show neonatal death, atelectasis, and impaired motor neuron and pancreas differentiation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(5)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Mnx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01602:Mnx1 APN 5 29477593 missense unknown
IGL01605:Mnx1 APN 5 29477593 missense unknown
3370:Mnx1 UTSW 5 29474887 missense unknown
R1752:Mnx1 UTSW 5 29477729 missense unknown
R1785:Mnx1 UTSW 5 29474189 missense unknown
R1786:Mnx1 UTSW 5 29474189 missense unknown
R1854:Mnx1 UTSW 5 29477782 missense unknown
R1866:Mnx1 UTSW 5 29474045 missense unknown
R1893:Mnx1 UTSW 5 29477830 missense unknown
R1899:Mnx1 UTSW 5 29473957 missense unknown
R2131:Mnx1 UTSW 5 29474189 missense unknown
R4698:Mnx1 UTSW 5 29474059 missense unknown
R4713:Mnx1 UTSW 5 29478131 missense probably damaging 1.00
R5171:Mnx1 UTSW 5 29474853 missense unknown
R6126:Mnx1 UTSW 5 29478112 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CTCAGATGAGCAGTCGGATG -3'
(R):5'- AGTCCTCTAGCGAAACCTCTTC -3'

Sequencing Primer
(F):5'- TGAGGCAGCATGGGCAC -3'
(R):5'- AGGGGTCCCGAATGCTTGTAC -3'
Posted On2019-06-07