Incidental Mutation 'PIT4472001:Podnl1'
ID555867
Institutional Source Beutler Lab
Gene Symbol Podnl1
Ensembl Gene ENSMUSG00000012889
Gene Namepodocan-like 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #PIT4472001 (G1)
Quality Score178.009
Status Not validated
Chromosome8
Chromosomal Location84125989-84132527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84127848 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 150 (V150M)
Ref Sequence ENSEMBL: ENSMUSP00000091073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040383] [ENSMUST00000093380] [ENSMUST00000117424]
Predicted Effect probably benign
Transcript: ENSMUST00000040383
SMART Domains Protein: ENSMUSP00000046449
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
DM14 137 194 1.02e-14 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 229 238 N/A INTRINSIC
DM14 250 308 8.7e-23 SMART
DM14 342 400 7.44e-31 SMART
low complexity region 457 478 N/A INTRINSIC
DM14 487 545 4.62e-27 SMART
C2 649 763 5.08e-8 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889
AA Change: V150M

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117424
SMART Domains Protein: ENSMUSP00000112556
Gene: ENSMUSG00000036686

DomainStartEndE-ValueType
low complexity region 41 51 N/A INTRINSIC
low complexity region 83 110 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 184 193 N/A INTRINSIC
DM14 205 263 8.7e-23 SMART
DM14 297 355 7.44e-31 SMART
low complexity region 411 432 N/A INTRINSIC
DM14 441 499 4.62e-27 SMART
C2 603 717 5.08e-8 SMART
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Podnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Podnl1 APN 8 84132195 missense probably benign 0.31
IGL03151:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03197:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03198:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03225:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03290:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03368:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03493:Podnl1 APN 8 84132189 missense probably benign 0.44
R1056:Podnl1 UTSW 8 84129276 missense probably benign 0.00
R1962:Podnl1 UTSW 8 84127297 missense probably benign 0.04
R4367:Podnl1 UTSW 8 84127268 missense probably benign 0.03
R4412:Podnl1 UTSW 8 84130665 missense probably benign 0.00
R4473:Podnl1 UTSW 8 84131985 missense possibly damaging 0.89
R4715:Podnl1 UTSW 8 84126061 start gained probably benign
R5009:Podnl1 UTSW 8 84126258 missense probably benign 0.01
R5013:Podnl1 UTSW 8 84126336 missense probably damaging 0.99
R5153:Podnl1 UTSW 8 84130643 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGAGAACTTCTATGTGGCCCAC -3'
(R):5'- TGCACAACTATGCCTCAGAC -3'

Sequencing Primer
(F):5'- AACAAGGTGAGCCTGTATCCCTG -3'
(R):5'- ACTATGCCTCAGACCCTCC -3'
Posted On2019-06-07