Incidental Mutation 'R0604:Psg27'
ID55587
Institutional Source Beutler Lab
Gene Symbol Psg27
Ensembl Gene ENSMUSG00000070797
Gene Namepregnancy-specific glycoprotein 27
SynonymsEG545925, cea15
MMRRC Submission 038793-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.019) question?
Stock #R0604 (G1)
Quality Score212
Status Not validated
Chromosome7
Chromosomal Location18556514-18567305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 18557072 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 402 (V402D)
Ref Sequence ENSEMBL: ENSMUSP00000092388 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094794]
Predicted Effect probably damaging
Transcript: ENSMUST00000094794
AA Change: V402D

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092388
Gene: ENSMUSG00000070797
AA Change: V402D

DomainStartEndE-ValueType
IG 39 140 4.13e-5 SMART
IG 159 260 5.89e-1 SMART
IG 279 380 1.39e-2 SMART
IGc2 396 460 3.62e-10 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik C A 2: 28,466,091 R60L possibly damaging Het
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
Acap1 T C 11: 69,884,625 E302G probably benign Het
Adrb2 G A 18: 62,178,515 T413I possibly damaging Het
Aqr T C 2: 114,130,604 K725R probably benign Het
Braf A G 6: 39,623,697 I662T probably damaging Het
Ccdc178 A G 18: 22,067,443 S435P probably benign Het
Chd9 A G 8: 91,036,542 M2332V possibly damaging Het
Clgn T C 8: 83,424,194 V496A probably benign Het
Dnah17 A C 11: 118,121,471 S193R probably benign Het
Dntt A G 19: 41,053,149 E424G probably benign Het
Fam149a A G 8: 45,345,008 L492P probably damaging Het
Fetub T C 16: 22,935,660 Y126H possibly damaging Het
Fgfr3 A T 5: 33,732,782 Y96F probably damaging Het
Gm4952 A G 19: 12,624,672 E148G probably benign Het
Gucy2g T A 19: 55,203,087 L977F probably benign Het
Il1r1 T C 1: 40,282,246 V6A probably benign Het
Itsn2 C A 12: 4,658,189 Q832K probably benign Het
Lats1 T A 10: 7,712,661 F1014Y probably damaging Het
Mcc G A 18: 44,473,756 A536V probably damaging Het
Mtrf1 T C 14: 79,415,887 V334A possibly damaging Het
Olfr1179 T C 2: 88,402,383 T184A probably benign Het
Olfr325 T A 11: 58,581,348 M168K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr50 T A 2: 36,794,107 Y290* probably null Het
Pard6g A G 18: 80,117,208 S179G probably damaging Het
Polr3a G A 14: 24,484,164 P91L probably damaging Het
Rttn A G 18: 88,977,758 I222V probably damaging Het
Sp9 T A 2: 73,273,638 S179T probably benign Het
Tbc1d8 T A 1: 39,405,326 H184L probably damaging Het
Vmn1r69 A G 7: 10,580,654 V50A probably benign Het
Vmn2r58 A G 7: 41,860,576 F526L possibly damaging Het
Other mutations in Psg27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Psg27 APN 7 18561804 missense probably damaging 1.00
IGL00417:Psg27 APN 7 18561917 missense probably benign 0.22
IGL01344:Psg27 APN 7 18560417 missense probably damaging 1.00
IGL01781:Psg27 APN 7 18565064 missense probably damaging 1.00
IGL02547:Psg27 APN 7 18560628 missense probably benign
IGL02926:Psg27 APN 7 18557129 missense probably damaging 0.99
IGL03074:Psg27 APN 7 18560529 missense probably benign 0.02
IGL03237:Psg27 APN 7 18560492 missense probably benign 0.00
IGL02796:Psg27 UTSW 7 18561950 missense probably benign 0.08
R0437:Psg27 UTSW 7 18560711 splice site probably benign
R1163:Psg27 UTSW 7 18565309 missense probably damaging 0.99
R2072:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2072:Psg27 UTSW 7 18565009 missense probably benign 0.16
R2073:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2074:Psg27 UTSW 7 18560417 missense probably damaging 1.00
R2081:Psg27 UTSW 7 18556958 missense probably damaging 1.00
R2206:Psg27 UTSW 7 18567111 nonsense probably null
R2866:Psg27 UTSW 7 18561893 missense probably benign
R3783:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R3784:Psg27 UTSW 7 18560354 missense probably damaging 1.00
R4463:Psg27 UTSW 7 18557085 missense possibly damaging 0.46
R5312:Psg27 UTSW 7 18557033 missense probably benign 0.43
R5885:Psg27 UTSW 7 18561786 missense probably damaging 0.96
R6087:Psg27 UTSW 7 18556944 missense probably benign 0.05
X0064:Psg27 UTSW 7 18561795 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGGGGTCACTCATTCATCACGG -3'
(R):5'- TTTGTAGGTTGCAGATGCAAAGCAC -3'

Sequencing Primer
(F):5'- TCATTCATCACGGCCAGG -3'
(R):5'- ATCTATAGTCACAGCTCCAATTTCTC -3'
Posted On2013-07-11