Incidental Mutation 'PIT4472001:Cxcl16'
ID555872
Institutional Source Beutler Lab
Gene Symbol Cxcl16
Ensembl Gene ENSMUSG00000018920
Gene Namechemokine (C-X-C motif) ligand 16
SynonymsSR-PSOX, Scavenger Receptor, SR-PSOX/CXCL16, 0910001K24Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #PIT4472001 (G1)
Quality Score169.009
Status Not validated
Chromosome11
Chromosomal Location70453983-70459984 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70458799 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 80 (G80R)
Ref Sequence ENSEMBL: ENSMUSP00000019064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019064] [ENSMUST00000039093] [ENSMUST00000092958] [ENSMUST00000108563] [ENSMUST00000126105] [ENSMUST00000126391] [ENSMUST00000147289]
Predicted Effect probably damaging
Transcript: ENSMUST00000019064
AA Change: G80R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019064
Gene: ENSMUSG00000018920
AA Change: G80R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Blast:SCY 32 94 1e-17 BLAST
transmembrane domain 201 223 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039093
SMART Domains Protein: ENSMUSP00000048816
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 307 353 6.7e-12 PFAM
low complexity region 438 452 N/A INTRINSIC
low complexity region 523 535 N/A INTRINSIC
low complexity region 702 736 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092958
SMART Domains Protein: ENSMUSP00000090635
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 164 186 N/A INTRINSIC
Pfam:zf-MYND 306 352 6.5e-11 PFAM
low complexity region 437 451 N/A INTRINSIC
low complexity region 483 495 N/A INTRINSIC
low complexity region 662 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108563
SMART Domains Protein: ENSMUSP00000104203
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
Pfam:zf-MYND 177 223 2.5e-11 PFAM
low complexity region 308 322 N/A INTRINSIC
low complexity region 393 405 N/A INTRINSIC
low complexity region 572 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126105
SMART Domains Protein: ENSMUSP00000134599
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 71 85 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126391
AA Change: G67R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133513
Gene: ENSMUSG00000018920
AA Change: G67R

DomainStartEndE-ValueType
Blast:SCY 19 81 3e-18 BLAST
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147289
SMART Domains Protein: ENSMUSP00000136813
Gene: ENSMUSG00000040829

DomainStartEndE-ValueType
low complexity region 40 54 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased NK T cells, decreased secretion and serum levels of IL4 and IFN-gamma, and decreased inhibition of B16 melanoma cell growth by alpha-galactosylceramide treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Cxcl16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Cxcl16 APN 11 70456032 missense possibly damaging 0.65
IGL02867:Cxcl16 APN 11 70459066 missense possibly damaging 0.62
R0133:Cxcl16 UTSW 11 70458770 missense possibly damaging 0.94
R0415:Cxcl16 UTSW 11 70458748 nonsense probably null
R0732:Cxcl16 UTSW 11 70455408 missense probably damaging 1.00
R0759:Cxcl16 UTSW 11 70459128 missense probably damaging 0.97
R4359:Cxcl16 UTSW 11 70458805 missense possibly damaging 0.81
R4609:Cxcl16 UTSW 11 70455429 missense probably damaging 1.00
R4903:Cxcl16 UTSW 11 70455693 missense probably benign 0.22
R4964:Cxcl16 UTSW 11 70455693 missense probably benign 0.22
R5724:Cxcl16 UTSW 11 70459164 missense probably damaging 0.99
Z1088:Cxcl16 UTSW 11 70455978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAATCCAGGAAGATG -3'
(R):5'- CAAGTCCCGGAGCCTAATTC -3'

Sequencing Primer
(F):5'- ATGATATTGGGAAAACACAGACTG -3'
(R):5'- AAGTCCCGGAGCCTAATTCCTTTC -3'
Posted On2019-06-07