Incidental Mutation 'PIT4472001:Krt16'
ID555874
Institutional Source Beutler Lab
Gene Symbol Krt16
Ensembl Gene ENSMUSG00000053797
Gene Namekeratin 16
SynonymsKrt1-16, K16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #PIT4472001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100246091-100248902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100247906 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 185 (T185S)
Ref Sequence ENSEMBL: ENSMUSP00000007280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007280]
Predicted Effect probably benign
Transcript: ENSMUST00000007280
AA Change: T185S

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000007280
Gene: ENSMUSG00000053797
AA Change: T185S

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 112 423 8.41e-170 SMART
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin and acts as an innate immune system effector, promoting the inflammatory response upon breach of the skin barrier. Defects in this gene are a cause of pachyonychia congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal and postnatal lethality, decreased body weight, abnormal tongue epithelium and hyperkertotic calluses in areas of physical pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Krt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Krt16 APN 11 100248717 nonsense probably null
IGL01794:Krt16 APN 11 100247905 missense probably benign 0.00
IGL01795:Krt16 APN 11 100247724 splice site probably benign
IGL02221:Krt16 APN 11 100246336 splice site probably benign
IGL02243:Krt16 APN 11 100246336 splice site probably benign
IGL02410:Krt16 APN 11 100246336 splice site probably benign
IGL02451:Krt16 APN 11 100246336 splice site probably benign
IGL02457:Krt16 APN 11 100246336 splice site probably benign
IGL02512:Krt16 APN 11 100246336 splice site probably benign
IGL02745:Krt16 APN 11 100246336 splice site probably benign
IGL02867:Krt16 APN 11 100247576 missense probably damaging 1.00
PIT4131001:Krt16 UTSW 11 100248749 missense unknown
R0268:Krt16 UTSW 11 100246525 splice site probably benign
R0709:Krt16 UTSW 11 100246454 splice site probably benign
R1560:Krt16 UTSW 11 100246649 missense probably damaging 1.00
R1728:Krt16 UTSW 11 100247707 missense probably damaging 1.00
R1996:Krt16 UTSW 11 100248788 missense unknown
R2927:Krt16 UTSW 11 100248799 missense unknown
R3806:Krt16 UTSW 11 100248740 missense unknown
R3907:Krt16 UTSW 11 100247163 missense possibly damaging 0.83
R5133:Krt16 UTSW 11 100247631 missense probably damaging 0.99
R5412:Krt16 UTSW 11 100246767 missense probably damaging 1.00
R5723:Krt16 UTSW 11 100248446 missense probably damaging 0.99
R6270:Krt16 UTSW 11 100247203 missense possibly damaging 0.51
R6368:Krt16 UTSW 11 100246676 missense probably damaging 1.00
R7191:Krt16 UTSW 11 100246658 missense probably damaging 1.00
R7314:Krt16 UTSW 11 100247869 missense probably damaging 1.00
R7446:Krt16 UTSW 11 100246784 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGCTCATTCTCGTACCTGGAAG -3'
(R):5'- GCACGTGCATATAACTTGAGCTG -3'

Sequencing Primer
(F):5'- CTCATTCTCGTACCTGGAAGGAGAG -3'
(R):5'- ACGTGCATATAACTTGAGCTGTGTAG -3'
Posted On2019-06-07