Incidental Mutation 'PIT4472001:Gskip'
ID555878
Institutional Source Beutler Lab
Gene Symbol Gskip
Ensembl Gene ENSMUSG00000044715
Gene NameGSK3B interacting protein
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #PIT4472001 (G1)
Quality Score217.009
Status Not validated
Chromosome12
Chromosomal Location105684829-105703023 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) C to T at 105684862 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041055] [ENSMUST00000051934] [ENSMUST00000222284]
Predicted Effect probably benign
Transcript: ENSMUST00000041055
SMART Domains Protein: ENSMUSP00000037441
Gene: ENSMUSG00000041341

DomainStartEndE-ValueType
Pfam:Chorein_N 11 127 3.5e-19 PFAM
low complexity region 286 298 N/A INTRINSIC
low complexity region 409 428 N/A INTRINSIC
low complexity region 864 870 N/A INTRINSIC
low complexity region 893 904 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
Pfam:ATG_C 1976 2071 1.4e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051934
SMART Domains Protein: ENSMUSP00000057939
Gene: ENSMUSG00000044715

DomainStartEndE-ValueType
Pfam:DUF727 38 138 1.2e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000222284
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved as a negative regulator of GSK3-beta in the Wnt signaling pathway. The encoded protein may play a role in the retinoic acid signaling pathway by regulating the functional interactions between GSK3-beta, beta-catenin and cyclin D1, and it regulates the beta-catenin/N-cadherin pool. The encoded protein contains a GSK3-beta interacting domain (GID) in its C-terminus, which is similar to the GID of Axin. The protein also contains an evolutionarily conserved RII-binding domain, which facilitates binding with protein kinase-A and GSK3-beta, enabling its role as an A-kinase anchoring protein. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial lethality between E16.5 and E1.5, complete lethality at birth, cyanosis, primary atelectasis resulting in respiratory failure and cleft secondary palate due to delayed ossification in the upper jaw. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Gskip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Gskip APN 12 105698844 missense probably damaging 1.00
R0525:Gskip UTSW 12 105698965 missense probably damaging 0.97
R2928:Gskip UTSW 12 105700743 missense probably damaging 1.00
R4328:Gskip UTSW 12 105700701 missense probably damaging 1.00
R4648:Gskip UTSW 12 105698729 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CTTACCCATTTGTCCAAGGGG -3'
(R):5'- CAACAAATTAGTCGCGCCG -3'

Sequencing Primer
(F):5'- AGCTTCTCCTGCAGGAA -3'
(R):5'- GGAGTCTTGTCTCGCCTCAG -3'
Posted On2019-06-07