Incidental Mutation 'PIT4472001:Ppp1r13b'
ID555879
Institutional Source Beutler Lab
Gene Symbol Ppp1r13b
Ensembl Gene ENSMUSG00000021285
Gene Nameprotein phosphatase 1, regulatory (inhibitor) subunit 13B
SynonymsASPP1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.791) question?
Stock #PIT4472001 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location111828457-111908110 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 111832640 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 864 (R864C)
Ref Sequence ENSEMBL: ENSMUSP00000062464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021714] [ENSMUST00000054815] [ENSMUST00000220486] [ENSMUST00000221375] [ENSMUST00000222843]
Predicted Effect probably benign
Transcript: ENSMUST00000021714
SMART Domains Protein: ENSMUSP00000021714
Gene: ENSMUSG00000021286

DomainStartEndE-ValueType
FYVE 36 105 7.11e-16 SMART
Pfam:ZFYVE21_C 108 233 1.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054815
AA Change: R864C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062464
Gene: ENSMUSG00000021285
AA Change: R864C

DomainStartEndE-ValueType
PDB:2UWQ|A 1 83 8e-35 PDB
Blast:RA 5 84 3e-47 BLAST
coiled coil region 123 305 N/A INTRINSIC
low complexity region 437 476 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 610 625 N/A INTRINSIC
PDB:4IRV|H 695 741 1e-12 PDB
ANK 917 946 4.16e-7 SMART
ANK 950 979 4.63e-5 SMART
SH3 1019 1077 1.79e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220486
AA Change: R741C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000221375
Predicted Effect probably benign
Transcript: ENSMUST00000222843
Predicted Effect probably benign
Transcript: ENSMUST00000223211
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. ASPP proteins are required for the induction of apoptosis by p53-family proteins. They promote DNA binding and transactivation of p53-family proteins on the promoters of proapoptotic genes. Expression of this gene is regulated by the E2F transcription factor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants show lymphatic vascular phenotypes with subcutaneous edema detected only during embryogenesis, delayed lymphatic vessel formation, and mispatterned collecting lymphatic vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Lats2 A C 14: 57,699,357 Y558* probably null Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Ppp1r13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Ppp1r13b APN 12 111829370 missense probably damaging 0.99
IGL01102:Ppp1r13b APN 12 111833219 missense probably benign
IGL01621:Ppp1r13b APN 12 111835092 missense possibly damaging 0.50
IGL01677:Ppp1r13b APN 12 111843665 missense probably benign 0.18
IGL01720:Ppp1r13b APN 12 111858260 missense probably benign 0.05
IGL01921:Ppp1r13b APN 12 111833237 missense probably benign
IGL02059:Ppp1r13b APN 12 111833347 missense probably damaging 1.00
IGL02187:Ppp1r13b APN 12 111835038 missense probably damaging 0.99
IGL02262:Ppp1r13b APN 12 111835211 missense possibly damaging 0.88
IGL02385:Ppp1r13b APN 12 111835043 missense probably damaging 1.00
IGL02894:Ppp1r13b APN 12 111831454 unclassified probably benign
IGL03027:Ppp1r13b APN 12 111830396 nonsense probably null
IGL03049:Ppp1r13b APN 12 111833229 missense probably benign 0.29
PIT4468001:Ppp1r13b UTSW 12 111838702 missense probably benign 0.08
R0393:Ppp1r13b UTSW 12 111835688 missense probably benign 0.01
R0561:Ppp1r13b UTSW 12 111866446 missense probably damaging 1.00
R1067:Ppp1r13b UTSW 12 111835116 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1208:Ppp1r13b UTSW 12 111844905 missense probably damaging 1.00
R1512:Ppp1r13b UTSW 12 111872408 missense possibly damaging 0.84
R1563:Ppp1r13b UTSW 12 111840982 missense probably damaging 1.00
R1918:Ppp1r13b UTSW 12 111834810 missense probably damaging 1.00
R2014:Ppp1r13b UTSW 12 111833788 missense probably benign
R2134:Ppp1r13b UTSW 12 111833733 missense probably benign 0.00
R2306:Ppp1r13b UTSW 12 111844893 missense probably damaging 1.00
R3508:Ppp1r13b UTSW 12 111872367 missense probably damaging 1.00
R3767:Ppp1r13b UTSW 12 111846417 missense probably damaging 0.99
R4237:Ppp1r13b UTSW 12 111838736 missense probably benign
R4278:Ppp1r13b UTSW 12 111830384 missense probably damaging 0.96
R4690:Ppp1r13b UTSW 12 111832558 missense probably damaging 1.00
R4702:Ppp1r13b UTSW 12 111833281 missense probably benign 0.00
R5094:Ppp1r13b UTSW 12 111843610 missense probably benign 0.00
R5250:Ppp1r13b UTSW 12 111844960 missense probably benign 0.20
R5444:Ppp1r13b UTSW 12 111838688 missense probably benign
R5607:Ppp1r13b UTSW 12 111833789 missense probably benign 0.44
R5874:Ppp1r13b UTSW 12 111844989 missense probably damaging 1.00
R5935:Ppp1r13b UTSW 12 111830442 missense probably benign
R6074:Ppp1r13b UTSW 12 111832402 missense probably damaging 1.00
R6253:Ppp1r13b UTSW 12 111835726 missense probably benign
R6511:Ppp1r13b UTSW 12 111831567 missense probably damaging 1.00
R6836:Ppp1r13b UTSW 12 111835195 missense probably benign 0.16
R6968:Ppp1r13b UTSW 12 111833178 missense possibly damaging 0.76
R7269:Ppp1r13b UTSW 12 111834919 missense probably damaging 0.99
R7284:Ppp1r13b UTSW 12 111834966 missense possibly damaging 0.82
R7304:Ppp1r13b UTSW 12 111872406 missense possibly damaging 0.49
R7314:Ppp1r13b UTSW 12 111846356 missense probably damaging 1.00
X0010:Ppp1r13b UTSW 12 111831459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CACCTAGGACACAGAGCATG -3'
(R):5'- AAATCTCCCCAGGAATAGCTG -3'

Sequencing Primer
(F):5'- TGTGAAAGCCAGCCCTTC -3'
(R):5'- AATAGCTGGCAGCCTCAGG -3'
Posted On2019-06-07