Incidental Mutation 'PIT4472001:Lats2'
ID555883
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Namelarge tumor suppressor 2
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #PIT4472001 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57689662-57758388 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 57699357 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 558 (Y558*)
Ref Sequence ENSEMBL: ENSMUSP00000022531 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000173964] [ENSMUST00000173990] [ENSMUST00000174166] [ENSMUST00000174213] [ENSMUST00000174694]
PDB Structure
Solution structure of RSGI RUH-038, a UBA domain from Mouse LATS2 (Large Tumor Suppressor homolog 2) [SOLUTION NMR]
Predicted Effect probably null
Transcript: ENSMUST00000022531
AA Change: Y558*
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: Y558*

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173964
AA Change: Y178*
SMART Domains Protein: ENSMUSP00000134142
Gene: ENSMUSG00000021959
AA Change: Y178*

DomainStartEndE-ValueType
low complexity region 21 28 N/A INTRINSIC
low complexity region 57 64 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
low complexity region 137 149 N/A INTRINSIC
Pfam:Pkinase 233 288 2.3e-5 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000173990
AA Change: Y558*
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: Y558*

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174166
SMART Domains Protein: ENSMUSP00000133379
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 5e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000174213
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect probably null
Transcript: ENSMUST00000174694
AA Change: Y558*
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: Y558*

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 93.7%
  • 3x: 90.8%
  • 10x: 84.2%
  • 20x: 70.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4gnt C A 9: 99,620,560 P258T probably damaging Het
Arvcf T C 16: 18,402,949 V714A possibly damaging Het
Bcas3 A G 11: 85,531,900 I532V probably damaging Het
Cbr1 T A 16: 93,609,804 V136E probably damaging Het
Ccdc27 T C 4: 154,041,727 M102V unknown Het
Ccr1 T C 9: 123,963,728 Y255C probably damaging Het
Cd300e T A 11: 115,054,510 I153F possibly damaging Het
Chd7 C T 4: 8,753,101 L533F unknown Het
Cpvl A T 6: 53,896,479 F424Y possibly damaging Het
Cxcl16 C T 11: 70,458,799 G80R probably damaging Het
Cyp2g1 T C 7: 26,814,194 V186A probably benign Het
Cyp4f15 T A 17: 32,702,824 M490K probably damaging Het
D630045J12Rik A T 6: 38,178,839 V1160D probably damaging Het
Fbn1 T C 2: 125,306,501 D2609G possibly damaging Het
Fgf5 T A 5: 98,261,979 V129E probably damaging Het
Fhl5 C A 4: 25,211,194 C166F probably damaging Het
Frem1 G A 4: 82,972,137 T1035I probably benign Het
Gcnt2 G A 13: 40,917,937 V19M probably benign Het
Gga1 C A 15: 78,893,636 A595D probably damaging Het
Gpaa1 C T 15: 76,334,740 T594I probably benign Het
Gskip C T 12: 105,684,862 probably benign Het
Ighv1-72 A G 12: 115,758,000 V112A probably damaging Het
Krt16 T A 11: 100,247,906 T185S probably benign Het
Lama1 T C 17: 67,764,704 V862A Het
Mast4 G A 13: 102,804,718 T277M probably damaging Het
Mnx1 T C 5: 29,474,107 E326G unknown Het
Mtmr10 A G 7: 64,333,358 E471G probably benign Het
Olfr488 C T 7: 108,256,103 V12M possibly damaging Het
Otog G A 7: 46,295,849 V2177M probably damaging Het
Ovgp1 A G 3: 105,986,990 E693G unknown Het
Pclo T C 5: 14,713,168 M600T possibly damaging Het
Pdgfra T A 5: 75,180,246 M622K probably damaging Het
Pdxdc1 A G 16: 13,845,345 L428P probably damaging Het
Pfkfb4 T C 9: 108,999,154 Y86H probably benign Het
Pik3cg A G 12: 32,204,984 Y335H probably damaging Het
Podnl1 G A 8: 84,127,848 V150M Het
Pou4f3 A G 18: 42,394,652 M4V probably benign Het
Ppp1r13b G A 12: 111,832,640 R864C probably damaging Het
R3hdm4 A G 10: 79,913,555 probably null Het
Skil T A 3: 31,098,232 V301D probably damaging Het
Sptb G A 12: 76,620,686 T879M probably damaging Het
St5 G A 7: 109,531,130 A888V probably damaging Het
Strip1 G A 3: 107,628,170 A79V probably benign Het
Tpgs2 G A 18: 25,168,595 T5M possibly damaging Het
Trim34a T A 7: 104,247,948 L73Q probably damaging Het
Trpv4 T A 5: 114,626,923 T677S probably damaging Het
Vmn2r23 A G 6: 123,712,977 T271A possibly damaging Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57691569 missense probably benign 0.09
IGL02104:Lats2 APN 14 57734012 missense probably damaging 1.00
IGL02173:Lats2 APN 14 57697260 missense probably damaging 1.00
IGL02377:Lats2 APN 14 57691595 missense probably damaging 1.00
IGL02995:Lats2 APN 14 57700348 missense probably damaging 1.00
R6846_Lats2_781 UTSW 14 57696134 missense probably damaging 1.00
R0653:Lats2 UTSW 14 57700196 nonsense probably null
R0780:Lats2 UTSW 14 57691296 missense probably damaging 1.00
R1129:Lats2 UTSW 14 57700333 missense possibly damaging 0.71
R1851:Lats2 UTSW 14 57697455 missense probably damaging 1.00
R1882:Lats2 UTSW 14 57697354 missense probably damaging 1.00
R2184:Lats2 UTSW 14 57691559 missense probably damaging 0.99
R3498:Lats2 UTSW 14 57722466 missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57691541 missense probably damaging 1.00
R4212:Lats2 UTSW 14 57696255 missense possibly damaging 0.82
R4357:Lats2 UTSW 14 57699383 missense probably damaging 1.00
R4962:Lats2 UTSW 14 57699592 missense probably damaging 1.00
R5394:Lats2 UTSW 14 57691353 missense probably benign 0.10
R5477:Lats2 UTSW 14 57699553 missense probably benign 0.00
R5729:Lats2 UTSW 14 57722735 missense probably benign 0.04
R5802:Lats2 UTSW 14 57694418 missense probably damaging 0.99
R5931:Lats2 UTSW 14 57696131 missense probably damaging 1.00
R6016:Lats2 UTSW 14 57734175 missense probably damaging 1.00
R6376:Lats2 UTSW 14 57722509 missense probably benign 0.00
R6624:Lats2 UTSW 14 57694312 critical splice donor site probably null
R6638:Lats2 UTSW 14 57699365 missense probably damaging 1.00
R6846:Lats2 UTSW 14 57696134 missense probably damaging 1.00
R7198:Lats2 UTSW 14 57697125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACCCCGTGTCTGAGATG -3'
(R):5'- TAAGTCTGAGCAGTACAGCG -3'

Sequencing Primer
(F):5'- CCCGTGTCTGAGATGGGTGC -3'
(R):5'- TCTGAGCAGTACAGCGTGGAC -3'
Posted On2019-06-07